Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427734835:

Variant ID: vg0427734835 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27734835
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.25, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGATTATGCCTGAGGCAACAATATTGTTAAACTGAATATGTTTGCACTAAAAAGCTGGATTGAACTCTGCAAAAATGACACGTACTCAATCAAATCTATT[G/A]
GTAGTTTGGTACAAAGCGAATTATTTTTGAGTGACATAAAACCACCGAATCTGGATATCTTTATTGGATAAATATGTACAAAGGAGCTTTTGACTCCAGG

Reverse complement sequence

CCTGGAGTCAAAAGCTCCTTTGTACATATTTATCCAATAAAGATATCCAGATTCGGTGGTTTTATGTCACTCAAAAATAATTCGCTTTGTACCAAACTAC[C/T]
AATAGATTTGATTGAGTACGTGTCATTTTTGCAGAGTTCAATCCAGCTTTTTAGTGCAAACATATTCAGTTTAACAATATTGTTGCCTCAGGCATAATCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	45.90%	0.25%	0.02%	NA
All Indica	2759	83.70%	15.90%	0.36%	0.04%	NA
All Japonica	1512	0.50%	99.50%	0.07%	0.00%	NA
Aus	269	74.00%	26.00%	0.00%	0.00%	NA
Indica I	595	80.00%	19.50%	0.34%	0.17%	NA
Indica II	465	91.80%	7.70%	0.43%	0.00%	NA
Indica III	913	83.40%	16.40%	0.22%	0.00%	NA
Indica Intermediate	786	81.90%	17.60%	0.51%	0.00%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	67.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427734835	G -> DEL	N	N	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N
vg0427734835	G -> A	LOC_Os04g46800.1	upstream_gene_variant ; 3389.0bp to feature; MODIFIER	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N
vg0427734835	G -> A	LOC_Os04g46770.1	downstream_gene_variant ; 3782.0bp to feature; MODIFIER	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N
vg0427734835	G -> A	LOC_Os04g46790.1	downstream_gene_variant ; 1646.0bp to feature; MODIFIER	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N
vg0427734835	G -> A	LOC_Os04g46780.1	intron_variant ; MODIFIER	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N
vg0427734835	G -> A	LOC_Os04g46780.2	intron_variant ; MODIFIER	silent_mutation	Average:41.381; most accessible tissue: Callus, score: 65.389	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427734835	NA	2.34E-06	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734835	NA	3.60E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734835	NA	1.42E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734835	NA	4.88E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734835	NA	1.73E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734835	NA	4.00E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251