Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427732885:

Variant ID: vg0427732885 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 27732885
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: Unkown

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGGAAAGGGAGCAAAAGGCCGAATCTTTTCCGCTGTTGCTGCTCCTCCTTTCTCGCTCTCGCTCTGTCCGATCGGAGCCATGAGTAATACGCTGCTTC[G/A]
TGTGCACCCTTCCGAGCTCAAGATCCCCTGTAAGTGCTTTCCAAGAACCAAACTCTTGATTGTTCGCAGCGTTGGCTTCAAGCTTTTCTTGACTGATTTT

Reverse complement sequence

AAAATCAGTCAAGAAAAGCTTGAAGCCAACGCTGCGAACAATCAAGAGTTTGGTTCTTGGAAAGCACTTACAGGGGATCTTGAGCTCGGAAGGGTGCACA[C/T]
GAAGCAGCGTATTACTCATGGCTCCGATCGGACAGAGCGAGAGCGAGAAAGGAGGAGCAGCAACAGCGGAAAAGATTCGGCCTTTTGCTCCCTTTCCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of Unkown(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 0.00% 18.47% 27.32% NA
All Indica  2759 34.70% 0.00% 22.87% 42.41% NA
All Japonica  1512 91.10% 0.00% 7.28% 1.65% NA
Aus  269 40.90% 0.00% 28.62% 30.48% NA
Indica I  595 45.50% 0.00% 22.86% 31.60% NA
Indica II  465 37.20% 0.00% 19.35% 43.44% NA
Indica III  913 19.80% 0.00% 26.07% 54.11% NA
Indica Intermediate  786 42.40% 0.00% 21.25% 36.39% NA
Temperate Japonica  767 96.60% 0.00% 2.87% 0.52% NA
Tropical Japonica  504 86.30% 0.00% 11.31% 2.38% NA
Japonica Intermediate  241 83.40% 0.00% 12.86% 3.73% NA
VI/Aromatic  96 57.30% 0.00% 36.46% 6.25% NA
Intermediate  90 68.90% 0.00% 22.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0427732885 G -> DEL LOC_Os04g46780.1 N frameshift_variant Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> DEL LOC_Os04g46780.2 N frameshift_variant Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> A LOC_Os04g46780.1 missense_variant ; p.Arg7His; MODERATE N Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> A LOC_Os04g46780.2 missense_variant ; p.Arg7His; MODERATE N Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> A LOC_Os04g46760.1 upstream_gene_variant ; 4394.0bp to feature; MODIFIER N Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> A LOC_Os04g46770.1 downstream_gene_variant ; 1832.0bp to feature; MODIFIER N Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N
vg0427732885 G -> A LOC_Os04g46790.1 downstream_gene_variant ; 3596.0bp to feature; MODIFIER N Average:75.114; most accessible tissue: Zhenshan97 root, score: 86.685 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0427732885 G A -0.09 -0.09 -0.09 -0.04 -0.06 -0.07