Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424200644:

Variant ID: vg0424200644 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 24200644
Reference Allele: GAlternative Allele: GAGA
Primary Allele: GSecondary Allele: GAGA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGACCCTGTCCTTGTGCGGGCGTTCCAAGAACGACTTCTCCGACAAGACTACGAACCGTGTCGTCGATGGCGTGGATGATGCCGACGGACTCTTCCCTC[G/GAGA]
AGAAGCTCAGGTCCAGGCGGCGGATGTCGTGCCGGCTCTCGCGCGACAGGAGGCTCTGCACCGCGCCCACCATCGCGTAGTTGTTCCTCGCGGCGTCGGA

Reverse complement sequence

TCCGACGCCGCGAGGAACAACTACGCGATGGTGGGCGCGGTGCAGAGCCTCCTGTCGCGCGAGAGCCGGCACGACATCCGCCGCCTGGACCTGAGCTTCT[C/TCTC]
GAGGGAAGAGTCCGTCGGCATCATCCACGCCATCGACGACACGGTTCGTAGTCTTGTCGGAGAAGTCGTTCTTGGAACGCCCGCACAAGGACAGGGTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.40% 0.32% 0.17% NA
All Indica  2759 31.80% 67.50% 0.43% 0.25% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 58.70% 41.30% 0.00% 0.00% NA
Indica I  595 4.70% 94.30% 0.50% 0.50% NA
Indica II  465 84.10% 15.50% 0.43% 0.00% NA
Indica III  913 20.20% 79.10% 0.44% 0.33% NA
Indica Intermediate  786 35.00% 64.50% 0.38% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 27.80% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424200644 G -> DEL LOC_Os04g40780.1 N frameshift_variant Average:78.665; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N
vg0424200644 G -> GAGA LOC_Os04g40780.1 inframe_insertion ; p.Phe95dup; MODERATE inframe_variant Average:78.665; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424200644 G GAGA -0.04 -0.05 -0.05 -0.12 -0.11 -0.14