| Variant ID: vg0424199539 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 24199539 |
| Reference Allele: A | Alternative Allele: AG |
| Primary Allele: A | Secondary Allele: AG |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 195. )
GCTCTTCTTGCAGATCACGAATCTCTTTATCAGCTCTTCCTCAACGGGTACACAGAGATGGTCCGTTGCCTACACAAATATAGCATTTTAGTGATTAACA[A/AG]
AAAAAAAGTTGAAAGAAGAGACAACGATGAATATCCGTACACTACCTATGGTTATAAATAAGCTTTCTGTTAGATAAGTTTTAGAAAAAATCTACTAATA
TATTAGTAGATTTTTTCTAAAACTTATCTAACAGAAAGCTTATTTATAACCATAGGTAGTGTACGGATATTCATCGTTGTCTCTTCTTTCAACTTTTTTT[T/CT]
TGTTAATCACTAAAATGCTATATTTGTGTAGGCAACGGACCATCTCTGTGTACCCGTTGAGGAAGAGCTGATAAAGAGATTCGTGATCTGCAAGAAGAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 33.90% | 0.23% | 1.90% | NA |
| All Indica | 2759 | 40.60% | 56.90% | 0.29% | 2.17% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 86.20% | 4.10% | 1.12% | 8.55% | NA |
| Indica I | 595 | 5.00% | 93.60% | 0.17% | 1.18% | NA |
| Indica II | 465 | 86.50% | 12.90% | 0.00% | 0.65% | NA |
| Indica III | 913 | 38.60% | 56.80% | 0.66% | 3.94% | NA |
| Indica Intermediate | 786 | 42.70% | 55.30% | 0.13% | 1.78% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0424199539 | A -> DEL | N | N | silent_mutation | Average:34.869; most accessible tissue: Callus, score: 76.576 | N | N | N | N |
| vg0424199539 | A -> AG | LOC_Os04g40770.1 | downstream_gene_variant ; 4190.0bp to feature; MODIFIER | silent_mutation | Average:34.869; most accessible tissue: Callus, score: 76.576 | N | N | N | N |
| vg0424199539 | A -> AG | LOC_Os04g40790.1 | downstream_gene_variant ; 2773.0bp to feature; MODIFIER | silent_mutation | Average:34.869; most accessible tissue: Callus, score: 76.576 | N | N | N | N |
| vg0424199539 | A -> AG | LOC_Os04g40780.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.869; most accessible tissue: Callus, score: 76.576 | N | N | N | N |