Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420225549:

Variant ID: vg0420225549 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 20225549
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, G: 0.07, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAACTAGCCCATCCAAGAGTGGCCAAAACTAAATGGAACATGATAGATAAAGTGAAGTGGTCTGCCTAGAATTACCATTTGCATAAGATACACAGGAT[G/T]
GCTATTAAACATATGCAGTAGACATATACAAGGTTGGTAGTAATCACATACAAGGTTGAACAGAGGGAAATGGGATGGCAGTGCATAACTGCATATATAT

Reverse complement sequence

ATATATATGCAGTTATGCACTGCCATCCCATTTCCCTCTGTTCAACCTTGTATGTGATTACTACCAACCTTGTATATGTCTACTGCATATGTTTAATAGC[C/A]
ATCCTGTGTATCTTATGCAAATGGTAATTCTAGGCAGACCACTTCACTTTATCTATCATGTTCCATTTAGTTTTGGCCACTCTTGGATGGGCTAGTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	37.50%	0.34%	0.23%	NA
All Indica	2759	94.90%	4.60%	0.36%	0.14%	NA
All Japonica	1512	3.20%	96.40%	0.20%	0.13%	NA
Aus	269	75.10%	24.90%	0.00%	0.00%	NA
Indica I	595	98.70%	0.70%	0.50%	0.17%	NA
Indica II	465	91.00%	8.40%	0.43%	0.22%	NA
Indica III	913	97.20%	2.70%	0.00%	0.11%	NA
Indica Intermediate	786	91.90%	7.40%	0.64%	0.13%	NA
Temperate Japonica	767	5.50%	94.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.20%	0.40%	0.20%	NA
Japonica Intermediate	241	0.40%	98.80%	0.41%	0.41%	NA
VI/Aromatic	96	25.00%	74.00%	1.04%	0.00%	NA
Intermediate	90	34.40%	57.80%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0420225549	G -> DEL	N	N	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33450.1	upstream_gene_variant ; 2475.0bp to feature; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33450.3	upstream_gene_variant ; 2475.0bp to feature; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33450.2	upstream_gene_variant ; 2467.0bp to feature; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33430.1	downstream_gene_variant ; 1335.0bp to feature; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33420.1	downstream_gene_variant ; 3673.0bp to feature; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N
vg0420225549	G -> T	LOC_Os04g33440.2	intron_variant ; MODIFIER	silent_mutation	Average:58.014; most accessible tissue: Callus, score: 87.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0420225549	NA	1.51E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420225549	NA	4.95E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420225549	NA	2.09E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420225549	NA	5.08E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420225549	NA	1.10E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251