| Variant ID: vg0420225252 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20225252 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 286. )
TAAATGTATGTGACTTCTTTATCGAAAAAATACTATGAGGCTTGCAGGGTTAGAAGAAGTTAACCCTTCCATAGGAGTATATGTTACAAGTTACTAGACA[C/G]
ATAGAGCCAGAGCAGAGATATCTGTGGACATGGATGAGTCTGCACATATTGCCATGTATAGATCTCCATACACAGATAATTCGAAAGCTAGATAACAATT
AATTGTTATCTAGCTTTCGAATTATCTGTGTATGGAGATCTATACATGGCAATATGTGCAGACTCATCCATGTCCACAGATATCTCTGCTCTGGCTCTAT[G/C]
TGTCTAGTAACTTGTAACATATACTCCTATGGAAGGGTTAACTTCTTCTAACCCTGCAAGCCTCATAGTATTTTTTCGATAAAGAAGTCACATACATTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 36.50% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 40.30% | 59.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 6.90% | 92.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 39.80% | 60.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420225252 | C -> G | LOC_Os04g33450.1 | upstream_gene_variant ; 2178.0bp to feature; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| vg0420225252 | C -> G | LOC_Os04g33450.3 | upstream_gene_variant ; 2178.0bp to feature; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| vg0420225252 | C -> G | LOC_Os04g33450.2 | upstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| vg0420225252 | C -> G | LOC_Os04g33430.1 | downstream_gene_variant ; 1632.0bp to feature; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| vg0420225252 | C -> G | LOC_Os04g33420.1 | downstream_gene_variant ; 3970.0bp to feature; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| vg0420225252 | C -> G | LOC_Os04g33440.2 | intron_variant ; MODIFIER | silent_mutation | Average:66.66; most accessible tissue: Callus, score: 87.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420225252 | NA | 4.09E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 4.93E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 9.30E-10 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 2.84E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 2.28E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 1.67E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 1.78E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 8.89E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 7.39E-19 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 3.32E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420225252 | NA | 3.32E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |