Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409081582:

Variant ID: vg0409081582 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9081582
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

GTGACGGATCTGCAACAGCGGCTGCGACAGCACTCACCGACAGATCTGGTGGGCATCATCACAAGGGTCTTATCTTCTTCGAGAGATAGCATGAGAGGGA[A/T]
TTGTGATTATTTTTTTATTTCTTATGGATGGTTCTTATGCATAAGGATAACTCATCCTAAGAACATCTATTAGGACTACTCCCATAGTATATAATGCCCA

Reverse complement sequence

TGGGCATTATATACTATGGGAGTAGTCCTAATAGATGTTCTTAGGATGAGTTATCCTTATGCATAAGAACCATCCATAAGAAATAAAAAAATAATCACAA[T/A]
TCCCTCTCATGCTATCTCTCGAAGAAGATAAGACCCTTGTGATGATGCCCACCAGATCTGTCGGTGAGTGCTGTCGCAGCCGCTGTTGCAGATCCGTCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	27.40%	0.04%	0.02%	NA
All Indica	2759	53.50%	46.50%	0.04%	0.04%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	23.40%	76.60%	0.00%	0.00%	NA
Indica II	465	74.80%	24.90%	0.22%	0.00%	NA
Indica III	913	59.10%	40.90%	0.00%	0.00%	NA
Indica Intermediate	786	57.00%	42.90%	0.00%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409081582	A -> DEL	N	N	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0409081582	A -> T	LOC_Os04g16680.1	upstream_gene_variant ; 3694.0bp to feature; MODIFIER	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0409081582	A -> T	LOC_Os04g16700.1	downstream_gene_variant ; 3482.0bp to feature; MODIFIER	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg0409081582	A -> T	LOC_Os04g16690.1	intron_variant ; MODIFIER	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409081582	NA	1.76E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	NA	7.66E-11	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	NA	3.13E-08	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	NA	1.42E-07	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	4.77E-08	NA	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	1.02E-07	4.21E-13	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	NA	1.28E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	NA	2.54E-11	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	1.37E-12	1.82E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081582	9.21E-11	2.00E-27	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251