Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409081468:

Variant ID: vg0409081468 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9081468
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGGCAACGACGGCAGTGCTCGCGAGCACGCGTGGATTCGACGAGGGTGGCTGCGGCGACGCTCGCGGACGCATTGGGGGTGACAGCAGCACTCGCGGG[C/T]
ACATCCAACAATGGTGACGGATCTGCAACAGCGGCTGCGACAGCACTCACCGACAGATCTGGTGGGCATCATCACAAGGGTCTTATCTTCTTCGAGAGAT

Reverse complement sequence

ATCTCTCGAAGAAGATAAGACCCTTGTGATGATGCCCACCAGATCTGTCGGTGAGTGCTGTCGCAGCCGCTGTTGCAGATCCGTCACCATTGTTGGATGT[G/A]
CCCGCGAGTGCTGCTGTCACCCCCAATGCGTCCGCGAGCGTCGCCGCAGCCACCCTCGTCGAATCCACGCGTGCTCGCGAGCACTGCCGTCGTTGCCAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.60%	0.15%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	65.40%	34.30%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	13.50%	85.70%	0.79%	0.00%	NA
Japonica Intermediate	241	74.70%	25.30%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409081468	C -> T	LOC_Os04g16690.1	synonymous_variant ; p.Gly46Gly; LOW	synonymous_codon	Average:70.491; most accessible tissue: Zhenshan97 young leaf, score: 86.22	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409081468	NA	2.38E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	5.05E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	5.75E-06	5.05E-26	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	1.68E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	7.76E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	8.75E-16	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	4.95E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	5.85E-13	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	8.14E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	2.54E-30	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	1.16E-19	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	5.03E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	2.31E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	1.59E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	9.76E-09	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	2.98E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	2.91E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	4.43E-06	1.09E-26	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	1.02E-17	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	2.77E-16	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	6.28E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	1.87E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409081468	NA	7.29E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251