Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332153141:

Variant ID: vg0332153141 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 32153141
Reference Allele: GGTAlternative Allele: AGT,G
Primary Allele: GGTSecondary Allele: AGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATCGACAGGAGCGAGTTCCAGGTGAACACGTTCCGCCGCGCCAAGGGGATCTCGTCGAACAGGCGTCGCGCGTCCCGCAACCCACCGGCGCCGCCGGC[GGT/AGT,G]
CTCGCCGTAGTAGGAGAGCAGGTTGTTGCAGAGGTAGGCGCTGGCGAGGAGGCCAGCCTTGACGGCGCGCGCGTGGATGGCACGGCCAGCGCCCGGGTTA

Reverse complement sequence

TAACCCGGGCGCTGGCCGTGCCATCCACGCGCGCGCCGTCAAGGCTGGCCTCCTCGCCAGCGCCTACCTCTGCAACAACCTGCTCTCCTACTACGGCGAG[ACC/ACT,C]
GCCGGCGGCGCCGGTGGGTTGCGGGACGCGCGACGCCTGTTCGACGAGATCCCCTTGGCGCGGCGGAACGTGTTCACCTGGAACTCGCTCCTGTCGATGT

Allele Frequencies:

Populations Population SizeFrequency of GGT(primary allele) Frequency of AGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 0.40% 1.08% 0.00% NA
All Indica  2759 97.50% 0.70% 1.81% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 0.00% 4.54% 0.00% NA
Indica II  465 98.30% 0.00% 1.72% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 98.00% 0.30% 1.78% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332153141 GGT -> AGT LOC_Os03g56400.1 synonymous_variant ; p.Thr74Thr; LOW N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> AGT LOC_Os03g56410.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> AGT LOC_Os03g56410.2 upstream_gene_variant ; 740.0bp to feature; MODIFIER N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> AGT LOC_Os03g56390.1 downstream_gene_variant ; 2383.0bp to feature; MODIFIER N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> G LOC_Os03g56400.1 frameshift_variant ; p.Thr74fs; HIGH N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> G LOC_Os03g56410.1 upstream_gene_variant ; 767.0bp to feature; MODIFIER N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N
vg0332153141 GGT -> G LOC_Os03g56410.2 upstream_gene_variant ; 739.0bp to feature; MODIFIER N Average:94.525; most accessible tissue: Zhenshan97 flag leaf, score: 98.647 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0332153141 GGT AGT -0.04 -0.06 -0.07 -0.04 -0.04 -0.05
vg0332153141 GGT G -0.11 -0.07 -0.01 -0.08 -0.1 -0.14