Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321792949:

Variant ID: vg0321792949 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21792949
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGATCGATCATGGCGGACGACATGCCGCCCGCCGTCGACGATGACCTCCAGGAGCTCATCGCCGAGCTCATGGAGGCCGGCCCGGAGGAAGAGGCCGA[C/A]
GACCGAGAGTGTGAGGAGATCACGGCCACAGCGCTGTCTGAAGCCACCGAGTACCTTGAGGACCCCGACCCTCCCTCGCCGGAGCAGGTGGACTGGGCGG

Reverse complement sequence

CCGCCCAGTCCACCTGCTCCGGCGAGGGAGGGTCGGGGTCCTCAAGGTACTCGGTGGCTTCAGACAGCGCTGTGGCCGTGATCTCCTCACACTCTCGGTC[G/T]
TCGGCCTCTTCCTCCGGGCCGGCCTCCATGAGCTCGGCGATGAGCTCCTGGAGGTCATCGTCGACGGCGGGCGGCATGTCGTCCGCCATGATCGATCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 44.80% 0.49% 2.41% NA
All Indica  2759 34.50% 64.40% 0.76% 0.36% NA
All Japonica  1512 91.10% 2.10% 0.07% 6.75% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 74.60% 24.70% 0.67% 0.00% NA
Indica II  465 13.80% 84.90% 1.08% 0.22% NA
Indica III  913 28.30% 70.80% 0.44% 0.55% NA
Indica Intermediate  786 23.70% 74.80% 1.02% 0.51% NA
Temperate Japonica  767 99.30% 0.30% 0.00% 0.39% NA
Tropical Japonica  504 89.90% 5.20% 0.00% 4.96% NA
Japonica Intermediate  241 67.20% 1.70% 0.41% 30.71% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321792949 C -> A LOC_Os03g39240.1 missense_variant ; p.Asp30Glu; MODERATE nonsynonymous_codon ; D30E Average:83.107; most accessible tissue: Minghui63 panicle, score: 89.175 benign 0.871 TOLERATED 0.29
vg0321792949 C -> DEL LOC_Os03g39240.1 N frameshift_variant Average:83.107; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0321792949 C A 0.02 0.02 0.03 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321792949 NA 2.26E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 1.70E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 1.19E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 6.52E-08 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 1.11E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 2.83E-08 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 2.28E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 9.45E-08 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792949 NA 2.09E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251