Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321792934:

Variant ID: vg0321792934 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21792934
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGTGCGTGCATCCATCGATCGATCATGGCGGACGACATGCCGCCCGCCGTCGACGATGACCTCCAGGAGCTCATCGCCGAGCTCATGGAGGCCGGCCC[G/T]
GAGGAAGAGGCCGACGACCGAGAGTGTGAGGAGATCACGGCCACAGCGCTGTCTGAAGCCACCGAGTACCTTGAGGACCCCGACCCTCCCTCGCCGGAGC

Reverse complement sequence

GCTCCGGCGAGGGAGGGTCGGGGTCCTCAAGGTACTCGGTGGCTTCAGACAGCGCTGTGGCCGTGATCTCCTCACACTCTCGGTCGTCGGCCTCTTCCTC[C/A]
GGGCCGGCCTCCATGAGCTCGGCGATGAGCTCCTGGAGGTCATCGTCGACGGCGGGCGGCATGTCGTCCGCCATGATCGATCGATGGATGCACGCACTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 18.40% 0.04% 2.71% NA
All Indica  2759 68.00% 31.10% 0.07% 0.83% NA
All Japonica  1512 93.10% 0.10% 0.00% 6.88% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 28.40% 70.80% 0.17% 0.67% NA
Indica II  465 88.00% 11.20% 0.00% 0.86% NA
Indica III  913 72.50% 26.60% 0.11% 0.77% NA
Indica Intermediate  786 80.80% 18.20% 0.00% 1.02% NA
Temperate Japonica  767 99.50% 0.10% 0.00% 0.39% NA
Tropical Japonica  504 95.00% 0.00% 0.00% 4.96% NA
Japonica Intermediate  241 68.50% 0.00% 0.00% 31.54% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321792934 G -> T LOC_Os03g39240.1 synonymous_variant ; p.Pro25Pro; LOW synonymous_codon Average:83.582; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N
vg0321792934 G -> DEL LOC_Os03g39240.1 N frameshift_variant Average:83.582; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0321792934 G T -0.02 -0.02 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321792934 NA 5.95E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 2.46E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 7.93E-07 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 1.20E-09 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 9.64E-10 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 8.22E-08 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 9.36E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 1.78E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 9.84E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 1.22E-07 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 6.75E-09 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 6.65E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 8.78E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 1.80E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321792934 NA 2.01E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251