Variant ID: vg0321315420 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 21315420 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTATCGTAGTTATATTTGATATATTTTTAGAGGGATTTTTGCGTTGAATGTTAGATCGATTATCCCAAAAATATCAGCTATCAAAATATATTTTTGACT[C/T]
AATATATATATTACTAATAAACGTACTATAATTAACTAGCTAATGAATGGCCTTGAGATATACACTCACCGAGTAAGTCGACGAAGTTGTAGCCATTGCT
AGCAATGGCTACAACTTCGTCGACTTACTCGGTGAGTGTATATCTCAAGGCCATTCATTAGCTAGTTAATTATAGTACGTTTATTAGTAATATATATATT[G/A]
AGTCAAAAATATATTTTGATAGCTGATATTTTTGGGATAATCGATCTAACATTCAACGCAAAAATCCCTCTAAAAATATATCAAATATAACTACGATAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0321315420 | C -> T | LOC_Os03g38390.1 | upstream_gene_variant ; 1900.0bp to feature; MODIFIER | N | Average:66.443; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
vg0321315420 | C -> T | LOC_Os03g38400.1 | intron_variant ; MODIFIER | N | Average:66.443; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |