Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320572180:

Variant ID: vg0320572180 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20572180
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTCAAAGATTTCAAGATGTATTAGATGTATCACTCCGACGAACATACAAGTCAACTTCTATTAGTTATAACAAAAATGATTTGATAAATATAATTGC[C/T]
AATGTATATATGTATCTGTCTGTCAATGCAAATAGTGTATTATAAAAAAACTATATATTGGATATATAGGTGTGGCGATCGCTGGACGTGGAGGGGAGCT

Reverse complement sequence

AGCTCCCCTCCACGTCCAGCGATCGCCACACCTATATATCCAATATATAGTTTTTTTATAATACACTATTTGCATTGACAGACAGATACATATATACATT[G/A]
GCAATTATATTTATCAAATCATTTTTGTTATAACTAATAGAAGTTGACTTGTATGTTCGTCGGAGTGATACATCTAATACATCTTGAAATCTTTGAATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.00% 0.00% 0.44% NA
All Indica  2759 97.60% 2.10% 0.00% 0.33% NA
All Japonica  1512 12.80% 86.80% 0.00% 0.46% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.00% 0.34% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.00% 0.00% 0.22% NA
Indica Intermediate  786 95.70% 3.70% 0.00% 0.64% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 34.10% 65.30% 0.00% 0.60% NA
Japonica Intermediate  241 7.50% 91.30% 0.00% 1.24% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 48.90% 45.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320572180 C -> T LOC_Os03g37110.1 upstream_gene_variant ; 3657.0bp to feature; MODIFIER silent_mutation Average:75.686; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0320572180 C -> T LOC_Os03g37130.1 downstream_gene_variant ; 2061.0bp to feature; MODIFIER silent_mutation Average:75.686; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0320572180 C -> T LOC_Os03g37120.1 intron_variant ; MODIFIER silent_mutation Average:75.686; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0320572180 C -> DEL N N silent_mutation Average:75.686; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320572180 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 1.34E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 5.81E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 5.58E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 3.09E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 1.29E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 9.54E-09 8.10E-113 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 4.27E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 2.66E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 8.27E-07 5.25E-112 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 6.35E-11 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 3.60E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 1.39E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320572180 NA 2.31E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251