Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320571133:

Variant ID: vg0320571133 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20571133
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, C: 0.09, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TACCTGCACGAAGACTGTACGCCACACCTTTTTTCTTTCTTTCTTTTTTAAACAAACGCAATTACACTTAATTTGGTCTTCAGCTTAATTTTCTGCATTC[A/C]
TTTAACCGTTCAATCGACTCTATTGTATTTGCAGGCCATCCTAGGATCATACATAGGGACATCAAGTCGGCCAACATCCTCCTGGATGACGCCTTCGAAG

Reverse complement sequence

CTTCGAAGGCGTCATCCAGGAGGATGTTGGCCGACTTGATGTCCCTATGTATGATCCTAGGATGGCCTGCAAATACAATAGAGTCGATTGAACGGTTAAA[T/G]
GAATGCAGAAAATTAAGCTGAAGACCAAATTAAGTGTAATTGCGTTTGTTTAAAAAAGAAAGAAAGAAAAAAGGTGTGGCGTACAGTCTTCGTGCAGGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	47.20%	0.08%	0.72%	NA
All Indica	2759	77.60%	21.50%	0.11%	0.83%	NA
All Japonica	1512	1.50%	97.90%	0.07%	0.46%	NA
Aus	269	88.50%	11.50%	0.00%	0.00%	NA
Indica I	595	92.80%	6.70%	0.00%	0.50%	NA
Indica II	465	73.10%	25.80%	0.00%	1.08%	NA
Indica III	913	68.60%	30.80%	0.00%	0.66%	NA
Indica Intermediate	786	79.10%	19.30%	0.38%	1.15%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	3.80%	95.40%	0.20%	0.60%	NA
Japonica Intermediate	241	0.80%	97.90%	0.00%	1.24%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	38.90%	56.70%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320571133	A -> C	LOC_Os03g37110.1	upstream_gene_variant ; 2610.0bp to feature; MODIFIER	silent_mutation	Average:75.425; most accessible tissue: Zhenshan97 root, score: 86.362	N	N	N	N
vg0320571133	A -> C	LOC_Os03g37130.1	downstream_gene_variant ; 3108.0bp to feature; MODIFIER	silent_mutation	Average:75.425; most accessible tissue: Zhenshan97 root, score: 86.362	N	N	N	N
vg0320571133	A -> C	LOC_Os03g37120.1	intron_variant ; MODIFIER	silent_mutation	Average:75.425; most accessible tissue: Zhenshan97 root, score: 86.362	N	N	N	N
vg0320571133	A -> DEL	N	N	silent_mutation	Average:75.425; most accessible tissue: Zhenshan97 root, score: 86.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320571133	8.40E-06	NA	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	4.06E-06	1.83E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	4.75E-06	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	NA	2.58E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	NA	6.74E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	3.90E-09	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	NA	3.43E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320571133	NA	2.85E-12	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251