Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320569880:

Variant ID: vg0320569880 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20569880
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCGGCATCTCCAGGCAAAAACCAGAGTCCCGCGTCGCCGTCCCAAGATTCACCTCCGCCAGTGGCGTCCCCGTCAGTATCCTCACCTCCTCCGGCACC[G/A]
ACGACACCGCCCTCTCCGCCCCCACCAAGCAAGTCCCCTCCACCGCCGTCTCCGCCTCCTACTACGTCGTCGACACCGCCATCGCATCAATCACCTCCGG

Reverse complement sequence

CCGGAGGTGATTGATGCGATGGCGGTGTCGACGACGTAGTAGGAGGCGGAGACGGCGGTGGAGGGGACTTGCTTGGTGGGGGCGGAGAGGGCGGTGTCGT[C/T]
GGTGCCGGAGGAGGTGAGGATACTGACGGGGACGCCACTGGCGGAGGTGAATCTTGGGACGGCGACGCGGGACTCTGGTTTTTGCCTGGAGATGCCGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.10% 0.00% 0.42% NA
All Indica  2759 97.60% 2.10% 0.00% 0.33% NA
All Japonica  1512 12.70% 86.90% 0.00% 0.40% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.00% 0.34% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.70% 1.10% 0.00% 0.22% NA
Indica Intermediate  786 95.70% 3.70% 0.00% 0.64% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 34.10% 65.30% 0.00% 0.60% NA
Japonica Intermediate  241 7.50% 91.70% 0.00% 0.83% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 48.90% 45.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320569880 G -> A LOC_Os03g37120.1 synonymous_variant ; p.Pro96Pro; LOW synonymous_codon Average:77.291; most accessible tissue: Zhenshan97 young leaf, score: 89.339 N N N N
vg0320569880 G -> DEL LOC_Os03g37120.1 N frameshift_variant Average:77.291; most accessible tissue: Zhenshan97 young leaf, score: 89.339 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0320569880 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320569880 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 3.44E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 4.13E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 5.32E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 1.83E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 8.57E-08 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 3.37E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 9.90E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 1.82E-06 3.24E-109 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 1.62E-09 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 3.56E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320569880 NA 5.96E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251