| Variant ID: vg0315011675 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 15011675 |
| Reference Allele: A | Alternative Allele: T,ATTTAAT |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAACAACTCATAACAAAATAAATTACAATTACGTAAATTTTTTGAATAAGACAAATGGTCAAACATGTGAGAAAAAGTCAACGGCGTCATCTATTAAAA[A/T,ATTTAAT]
AACGGAGGTAGTATGTTATTCCCTTTTCTGCATCCATGATAGATATTGCCTCTGGTTTTAAATGGACAAATCGGACGTCTGGCATTTCTCAGAACATCGG
CCGATGTTCTGAGAAATGCCAGACGTCCGATTTGTCCATTTAAAACCAGAGGCAATATCTATCATGGATGCAGAAAAGGGAATAACATACTACCTCCGTT[T/A,ATTAAAT]
TTTTAATAGATGACGCCGTTGACTTTTTCTCACATGTTTGACCATTTGTCTTATTCAAAAAATTTACGTAATTGTAATTTATTTTGTTATGAGTTGTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 20.90% | 0.38% | 0.34% | ATTTAAT: 0.02% |
| All Indica | 2759 | 98.30% | 0.50% | 0.65% | 0.58% | NA |
| All Japonica | 1512 | 40.30% | 59.70% | 0.00% | 0.00% | ATTTAAT: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.20% | 0.67% | 0.67% | NA |
| Indica II | 465 | 97.40% | 0.20% | 1.29% | 1.08% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.20% | 0.00% | 1.02% | 0.76% | NA |
| Temperate Japonica | 767 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 25.20% | 0.00% | 0.00% | ATTTAAT: 0.20% |
| Japonica Intermediate | 241 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315011675 | A -> T | LOC_Os03g26240.1 | upstream_gene_variant ; 2222.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> T | LOC_Os03g26260.1 | upstream_gene_variant ; 4131.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> T | LOC_Os03g26229.1 | downstream_gene_variant ; 3415.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> T | LOC_Os03g26250.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> ATTTAAT | LOC_Os03g26240.1 | upstream_gene_variant ; 2223.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> ATTTAAT | LOC_Os03g26260.1 | upstream_gene_variant ; 4130.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> ATTTAAT | LOC_Os03g26229.1 | downstream_gene_variant ; 3416.0bp to feature; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> ATTTAAT | LOC_Os03g26250.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| vg0315011675 | A -> DEL | N | N | silent_mutation | Average:41.124; most accessible tissue: Callus, score: 67.433 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315011675 | NA | 4.89E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011675 | NA | 1.01E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011675 | NA | 5.79E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011675 | NA | 1.80E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011675 | NA | 3.26E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011675 | NA | 6.48E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |