Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315011619:

Variant ID: vg0315011619 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15011619
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTTTATGTAAATATATAAAATATAAATCACACTTAAAGTATTATGAGTAATAAAACAACTCATAACAAAATAAATTACAATTACGTAAATTTTTT[G/A]
AATAAGACAAATGGTCAAACATGTGAGAAAAAGTCAACGGCGTCATCTATTAAAAAAACGGAGGTAGTATGTTATTCCCTTTTCTGCATCCATGATAGAT

Reverse complement sequence

ATCTATCATGGATGCAGAAAAGGGAATAACATACTACCTCCGTTTTTTTAATAGATGACGCCGTTGACTTTTTCTCACATGTTTGACCATTTGTCTTATT[C/T]
AAAAAATTTACGTAATTGTAATTTATTTTGTTATGAGTTGTTTTATTACTCATAATACTTTAAGTGTGATTTATATTTTATATATTTACATAAAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.20%	0.40%	0.00%	NA
All Indica	2759	29.90%	69.60%	0.54%	0.00%	NA
All Japonica	1512	77.90%	22.00%	0.13%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	55.00%	44.40%	0.67%	0.00%	NA
Indica II	465	49.50%	49.90%	0.65%	0.00%	NA
Indica III	913	11.70%	87.80%	0.44%	0.00%	NA
Indica Intermediate	786	20.40%	79.10%	0.51%	0.00%	NA
Temperate Japonica	767	96.00%	3.90%	0.13%	0.00%	NA
Tropical Japonica	504	51.40%	48.40%	0.20%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	35.40%	1.04%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315011619	G -> A	LOC_Os03g26240.1	upstream_gene_variant ; 2166.0bp to feature; MODIFIER	silent_mutation	Average:48.956; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0315011619	G -> A	LOC_Os03g26260.1	upstream_gene_variant ; 4187.0bp to feature; MODIFIER	silent_mutation	Average:48.956; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0315011619	G -> A	LOC_Os03g26229.1	downstream_gene_variant ; 3359.0bp to feature; MODIFIER	silent_mutation	Average:48.956; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0315011619	G -> A	LOC_Os03g26250.1	intron_variant ; MODIFIER	silent_mutation	Average:48.956; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315011619	NA	1.26E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315011619	NA	7.94E-07	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	2.84E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	1.50E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	8.12E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	5.59E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	3.36E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	3.06E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	8.42E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	2.38E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	7.00E-12	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011619	NA	2.50E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251