| Variant ID: vg0315011523 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 15011523 |
| Reference Allele: ATTT | Alternative Allele: TTTT,A |
| Primary Allele: ATTT | Secondary Allele: TTTT |
Inferred Ancestral Allele: Not determined.
TCCAGGTATATATAGCTGCTACTAGATACTCCCTCTATTTTTTAATAGACGACGCCGTTGACTTTTTCTTCCATATTTGACTATTCGTCTTATTCAAAAA[ATTT/TTTT,A]
TATGTAAATATATAAAATATAAATCACACTTAAAGTATTATGAGTAATAAAACAACTCATAACAAAATAAATTACAATTACGTAAATTTTTTGAATAAGA
TCTTATTCAAAAAATTTACGTAATTGTAATTTATTTTGTTATGAGTTGTTTTATTACTCATAATACTTTAAGTGTGATTTATATTTTATATATTTACATA[AAAT/AAAA,T]
TTTTTGAATAAGACGAATAGTCAAATATGGAAGAAAAAGTCAACGGCGTCGTCTATTAAAAAATAGAGGGAGTATCTAGTAGCAGCTATATATACCTGGA
| Populations | Population Size | Frequency of ATTT(primary allele) | Frequency of TTTT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 20.90% | 0.00% | 0.00% | A: 0.08% |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | A: 0.07% |
| All Japonica | 1512 | 40.30% | 59.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.00% | 0.00% | A: 0.25% |
| Temperate Japonica | 767 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 0.00% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315011523 | ATTT -> A | LOC_Os03g26240.1 | upstream_gene_variant ; 2071.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> A | LOC_Os03g26260.1 | upstream_gene_variant ; 4282.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> A | LOC_Os03g26229.1 | downstream_gene_variant ; 3264.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> A | LOC_Os03g26250.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> TTTT | LOC_Os03g26240.1 | upstream_gene_variant ; 2070.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> TTTT | LOC_Os03g26260.1 | upstream_gene_variant ; 4283.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> TTTT | LOC_Os03g26229.1 | downstream_gene_variant ; 3263.0bp to feature; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| vg0315011523 | ATTT -> TTTT | LOC_Os03g26250.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.935; most accessible tissue: Callus, score: 78.971 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315011523 | NA | 1.67E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 3.46E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 6.00E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 8.20E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 9.30E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 7.92E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 2.63E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315011523 | NA | 1.39E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |