Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315011511:

Variant ID: vg0315011511 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15011511
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGTCGATATGTCCAGGTATATATAGCTGCTACTAGATACTCCCTCTATTTTTTAATAGACGACGCCGTTGACTTTTTCTTCCATATTTGACTATTCGT[C/T]
TTATTCAAAAAATTTTATGTAAATATATAAAATATAAATCACACTTAAAGTATTATGAGTAATAAAACAACTCATAACAAAATAAATTACAATTACGTAA

Reverse complement sequence

TTACGTAATTGTAATTTATTTTGTTATGAGTTGTTTTATTACTCATAATACTTTAAGTGTGATTTATATTTTATATATTTACATAAAATTTTTTGAATAA[G/A]
ACGAATAGTCAAATATGGAAGAAAAAGTCAACGGCGTCGTCTATTAAAAAATAGAGGGAGTATCTAGTAGCAGCTATATATACCTGGACATATCGACGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	22.80%	0.34%	0.00%	NA
All Indica	2759	74.40%	25.10%	0.47%	0.00%	NA
All Japonica	1512	91.60%	8.30%	0.13%	0.00%	NA
Aus	269	15.20%	84.40%	0.37%	0.00%	NA
Indica I	595	46.20%	53.10%	0.67%	0.00%	NA
Indica II	465	57.20%	42.20%	0.65%	0.00%	NA
Indica III	913	96.70%	3.20%	0.11%	0.00%	NA
Indica Intermediate	786	80.20%	19.20%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	77.80%	22.00%	0.20%	0.00%	NA
Japonica Intermediate	241	94.60%	5.00%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315011511	C -> T	LOC_Os03g26240.1	upstream_gene_variant ; 2058.0bp to feature; MODIFIER	silent_mutation	Average:59.174; most accessible tissue: Callus, score: 78.971	N	N	N	N
vg0315011511	C -> T	LOC_Os03g26260.1	upstream_gene_variant ; 4295.0bp to feature; MODIFIER	silent_mutation	Average:59.174; most accessible tissue: Callus, score: 78.971	N	N	N	N
vg0315011511	C -> T	LOC_Os03g26229.1	downstream_gene_variant ; 3251.0bp to feature; MODIFIER	silent_mutation	Average:59.174; most accessible tissue: Callus, score: 78.971	N	N	N	N
vg0315011511	C -> T	LOC_Os03g26250.1	intron_variant ; MODIFIER	silent_mutation	Average:59.174; most accessible tissue: Callus, score: 78.971	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315011511	NA	2.47E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	1.13E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	1.03E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	5.09E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	1.22E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	9.11E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	3.05E-06	mr1634	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315011511	NA	4.42E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251