Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304211945:

Variant ID: vg0304211945 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4211945
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAATATGGTCTCAATGCCAAATTATCACTAGCAGAACAAATTATGTGGAACCTAATGCTACAACATATATACTACTAGAAAGCAAGAGCCTTCATAAG[G/A]
AAACTGATGGCAAATATGAAAGAGCTTAATTAATATGGTATGCTTGCATTTGATCCAAATTTTGTGGTGTTTTCGCAGTCCCCAAAAGAAAAAGGGCAGT

Reverse complement sequence

ACTGCCCTTTTTCTTTTGGGGACTGCGAAAACACCACAAAATTTGGATCAAATGCAAGCATACCATATTAATTAAGCTCTTTCATATTTGCCATCAGTTT[C/T]
CTTATGAAGGCTCTTGCTTTCTAGTAGTATATATGTTGTAGCATTAGGTTCCACATAATTTGTTCTGCTAGTGATAATTTGGCATTGAGACCATATTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.20%	0.80%	0.04%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.40%	3.60%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304211945	G -> A	LOC_Os03g08270.1	downstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08284.3	downstream_gene_variant ; 4751.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08270.2	downstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08270.3	downstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08270.5	downstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08270.6	downstream_gene_variant ; 1640.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08284.1	downstream_gene_variant ; 4751.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08284.2	downstream_gene_variant ; 4751.0bp to feature; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08280.1	intron_variant ; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08280.2	intron_variant ; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N
vg0304211945	G -> A	LOC_Os03g08280.3	intron_variant ; MODIFIER	silent_mutation	Average:57.225; most accessible tissue: Callus, score: 84.538	N	N	N	N