Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302880721:

Variant ID: vg0302880721 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 2880721
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTAACAGCGACCAAAAGCTCGATGATATTTTCTCTTTTCATTTTCCCTTTTTTTTTTGTCATTCTTGTTAAGAATTCGTTGCCAACTCAATCTGGC[T/C]
GGCAAATAAAAGTGTATTAAATTTCCCCTTTTTATATAGAGAGACAGGTACACAATTGTAATTGTTTTTTTAGATCAACCAATGCATGTGAAACGATATA

Reverse complement sequence

TATATCGTTTCACATGCATTGGTTGATCTAAAAAAACAATTACAATTGTGTACCTGTCTCTCTATATAAAAAGGGGAAATTTAATACACTTTTATTTGCC[A/G]
GCCAGATTGAGTTGGCAACGAATTCTTAACAAGAATGACAAAAAAAAAAGGGAAAATGAAAAGAGAAAATATCATCGAGCTTTTGGTCGCTGTTAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.00%	0.19%	0.30%	NA
All Indica	2759	96.00%	3.50%	0.29%	0.22%	NA
All Japonica	1512	0.40%	99.40%	0.00%	0.20%	NA
Aus	269	48.70%	51.30%	0.00%	0.00%	NA
Indica I	595	98.00%	1.30%	0.34%	0.34%	NA
Indica II	465	93.50%	5.80%	0.65%	0.00%	NA
Indica III	913	99.50%	0.40%	0.00%	0.11%	NA
Indica Intermediate	786	92.00%	7.30%	0.38%	0.38%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.60%	0.00%	0.20%	NA
Japonica Intermediate	241	0.80%	98.30%	0.00%	0.83%	NA
VI/Aromatic	96	36.50%	62.50%	0.00%	1.04%	NA
Intermediate	90	44.40%	50.00%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0302880721	T -> C	LOC_Os03g05770.1	3_prime_UTR_variant ; 305.0bp to feature; MODIFIER	silent_mutation	Average:46.568; most accessible tissue: Callus, score: 89.101	N	N	N	N
vg0302880721	T -> C	LOC_Os03g05780.1	downstream_gene_variant ; 2284.0bp to feature; MODIFIER	silent_mutation	Average:46.568; most accessible tissue: Callus, score: 89.101	N	N	N	N
vg0302880721	T -> DEL	N	N	silent_mutation	Average:46.568; most accessible tissue: Callus, score: 89.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0302880721	NA	7.96E-49	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	1.42E-34	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	1.60E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	1.94E-73	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	1.77E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	7.47E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	4.02E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302880721	NA	5.48E-50	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251