| Variant ID: vg0235786272 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35786272 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )
AGTCCAATTGTTTTCCCTGAGTTGGAAATAAGGCATCTGCAAACAAATAAATTTTCTTTTAGAAAATCCATTACCAGAAGACAGATAATTTAGGCTAATG[C/T]
ACTGTGTGAGAATGACTGGGAGGCCCAATAAGTATAGGCAAAATTTTGAGGGGATCAGAGCCAAGGAGATAATTGATCATTTGATTTCCATTGACCTTTT
AAAAGGTCAATGGAAATCAAATGATCAATTATCTCCTTGGCTCTGATCCCCTCAAAATTTTGCCTATACTTATTGGGCCTCCCAGTCATTCTCACACAGT[G/A]
CATTAGCCTAAATTATCTGTCTTCTGGTAATGGATTTTCTAAAAGAAAATTTATTTGTTTGCAGATGCCTTATTTCCAACTCAGGGAAAACAATTGGACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 40.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235786272 | C -> T | LOC_Os02g58540.1 | upstream_gene_variant ; 2126.0bp to feature; MODIFIER | silent_mutation | Average:60.113; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786272 | C -> T | LOC_Os02g58554.1 | upstream_gene_variant ; 3775.0bp to feature; MODIFIER | silent_mutation | Average:60.113; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786272 | C -> T | LOC_Os02g58530.1 | downstream_gene_variant ; 4884.0bp to feature; MODIFIER | silent_mutation | Average:60.113; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786272 | C -> T | LOC_Os02g58550.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.113; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786272 | C -> T | LOC_Os02g58550.2 | intron_variant ; MODIFIER | silent_mutation | Average:60.113; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235786272 | NA | 5.39E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 6.31E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 3.59E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 3.34E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 3.25E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 1.36E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 8.83E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 1.35E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 1.80E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786272 | NA | 1.28E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/