| Variant ID: vg0235786238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35786238 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
TAACATCCCATTTTCCATCCATATAAGCATTAAAAGTCCAATTGTTTTCCCTGAGTTGGAAATAAGGCATCTGCAAACAAATAAATTTTCTTTTAGAAAA[T/A]
CCATTACCAGAAGACAGATAATTTAGGCTAATGCACTGTGTGAGAATGACTGGGAGGCCCAATAAGTATAGGCAAAATTTTGAGGGGATCAGAGCCAAGG
CCTTGGCTCTGATCCCCTCAAAATTTTGCCTATACTTATTGGGCCTCCCAGTCATTCTCACACAGTGCATTAGCCTAAATTATCTGTCTTCTGGTAATGG[A/T]
TTTTCTAAAAGAAAATTTATTTGTTTGCAGATGCCTTATTTCCAACTCAGGGAAAACAATTGGACTTTTAATGCTTATATGGATGGAAAATGGGATGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 40.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235786238 | T -> A | LOC_Os02g58540.1 | upstream_gene_variant ; 2092.0bp to feature; MODIFIER | silent_mutation | Average:59.176; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786238 | T -> A | LOC_Os02g58554.1 | upstream_gene_variant ; 3809.0bp to feature; MODIFIER | silent_mutation | Average:59.176; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786238 | T -> A | LOC_Os02g58530.1 | downstream_gene_variant ; 4850.0bp to feature; MODIFIER | silent_mutation | Average:59.176; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786238 | T -> A | LOC_Os02g58550.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.176; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| vg0235786238 | T -> A | LOC_Os02g58550.2 | intron_variant ; MODIFIER | silent_mutation | Average:59.176; most accessible tissue: Callus, score: 79.979 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235786238 | NA | 1.25E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 3.27E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 2.74E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 2.23E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 4.49E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 1.82E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 1.04E-19 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 5.70E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 7.81E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235786238 | NA | 1.36E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/