Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229206399:

Variant ID: vg0229206399 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 29206399
Reference Allele: TGAlternative Allele: T
Primary Allele: TGSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTACCAAACCCCAATGCATGCAGCAACAATGCACAAGCACAATACACACCCTCTGCCAAAAGGAATCCTACAAACCCGAAAGGCAAAGTCAAAAGCATG[TG/T]
GTGCCCAAGGCCAAGATAGGCAGCAGAGAGCATTGCATTGCAAATGCCACTGCGAATTCTGCTACTACTCCAACACAATACTACATACAAGCACAGCCGC

Reverse complement sequence

GCGGCTGTGCTTGTATGTAGTATTGTGTTGGAGTAGTAGCAGAATTCGCAGTGGCATTTGCAATGCAATGCTCTCTGCTGCCTATCTTGGCCTTGGGCAC[CA/A]
CATGCTTTTGACTTTGCCTTTCGGGTTTGTAGGATTCCTTTTGGCAGAGGGTGTGTATTGTGCTTGTGCATTGTTGCTGCATGCATTGGGGTTTGGTACT

Allele Frequencies:

Populations Population SizeFrequency of TG(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 40.60% 0.06% 0.00% NA
All Indica  2759 31.80% 68.10% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 12.30% 87.60% 0.17% 0.00% NA
Indica II  465 43.40% 56.60% 0.00% 0.00% NA
Indica III  913 31.30% 68.70% 0.00% 0.00% NA
Indica Intermediate  786 40.10% 59.70% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229206399 TG -> T LOC_Os02g47760.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:87.795; most accessible tissue: Zhenshan97 panicle, score: 99.425 N N N N
vg0229206399 TG -> T LOC_Os02g47770.1 intron_variant ; MODIFIER silent_mutation Average:87.795; most accessible tissue: Zhenshan97 panicle, score: 99.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229206399 TG T 0.1 0.01 -0.02 0.02 0.03 0.06