RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0227603365:

Variant ID: vg0227603365 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27603365
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCAAAGTTGAATAAAATAATTCCAAATTCACAAAAAAAAATTCGGCCAAAATAATATCATTGGGGGGGGGGGTCCGATATGATCGAAATTTCGTTC[C/T]
GGAATTTTGAACCCTGGATATACCTGGATACAAATTAGACAACAATTCAATGCTTCAAACTTGTTTAGTTGTGCATGACGTGCAAATTCTGTTATATAGC

Reverse complement sequence

GCTATATAACAGAATTTGCACGTCATGCACAACTAAACAAGTTTGAAGCATTGAATTGTTGTCTAATTTGTATCCAGGTATATCCAGGGTTCAAAATTCC[G/A]
GAACGAAATTTCGATCATATCGGACCCCCCCCCCCAATGATATTATTTTGGCCGAATTTTTTTTTGTGAATTTGGAATTATTTTATTCAACTTTGACTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	46.10%	0.25%	0.00%	NA
All Indica	2759	89.40%	10.20%	0.36%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	11.20%	88.80%	0.00%	0.00%	NA
Indica I	595	96.50%	3.50%	0.00%	0.00%	NA
Indica II	465	89.70%	9.90%	0.43%	0.00%	NA
Indica III	913	88.20%	11.60%	0.22%	0.00%	NA
Indica Intermediate	786	85.40%	13.90%	0.76%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	33.30%	64.40%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227603365	C -> T	LOC_Os02g45390.1	intron_variant ; MODIFIER	silent_mutation	Average:45.197; most accessible tissue: Minghui63 flower, score: 67.808	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227603365	NA	2.91E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227603365	NA	1.69E-31	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227603365	NA	5.70E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227603365	NA	3.70E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227603365	NA	4.31E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227603365	NA	2.12E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0227603365:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact