Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226609582:

Variant ID: vg0226609582 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 26609582
Reference Allele: ATAlternative Allele: ATT,A,ATTT
Primary Allele: ATTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGGTGGCGATGAACTCCGCCACGTAGGCCTTCACGGACGTGGCGCTGAAGGAGTCACCCAAGCTTCCGAATGCGAGCTTCACCATTTTTAATCTAT[AT/ATT,A,ATTT]
TTTTTTCCTTATTACTCTGATAAGTGTGGAGAGGTCTCTACGCTTGAAAGAGAGCTTGGCGATTACTGATGTGGCGAAGCTCGTTCAGCTTAGGCCCCTT

Reverse complement sequence

AAGGGGCCTAAGCTGAACGAGCTTCGCCACATCAGTAATCGCCAAGCTCTCTTTCAAGCGTAGAGACCTCTCCACACTTATCAGAGTAATAAGGAAAAAA[AT/AAT,T,AAAT]
ATAGATTAAAAATGGTGAAGCTCGCATTCGGAAGCTTGGGTGACTCCTTCAGCGCCACGTCCGTGAAGGCCTACGTGGCGGAGTTCATCGCCACCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of ATT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.60% 0.11% 0.00% A: 0.13%; ATTT: 0.02%
All Indica  2759 91.70% 7.90% 0.14% 0.00% A: 0.22%; ATTT: 0.04%
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 83.50% 15.70% 0.11% 0.00% A: 0.66%; ATTT: 0.11%
Indica Intermediate  786 93.30% 6.60% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0226609582 AT -> A LOC_Os02g44080.1 5_prime_UTR_variant ; 13.0bp to feature; MODIFIER silent_mutation Average:63.73; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0226609582 AT -> ATTT LOC_Os02g44080.1 5_prime_UTR_variant ; 14.0bp to feature; MODIFIER silent_mutation Average:63.73; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0226609582 AT -> ATT LOC_Os02g44080.1 5_prime_UTR_variant ; 14.0bp to feature; MODIFIER silent_mutation Average:63.73; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0226609582 AT A 0.3 0.0 -0.04 -0.02 -0.02 -0.02
vg0226609582 AT ATT 0.32 0.03 0.01 0.01 0.05 0.03
vg0226609582 AT ATTT 0.3 -0.11 -0.1 0.03 -0.04 -0.07