RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0223953316:

Variant ID: vg0223953316 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23953316
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, T: 0.47, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

TTACCTTCACCTGCTTGACCTTTCTGGTAATCGCTTCTCTGGGCAGATACCTCGCCTGAACAGTCTCCGAAAATTGCAAGTCCTCAACCTGAGTAACAAT[A/T]
TTTTGGACGGGATCATTCCGGACACGCTTACAAACTGTTCCAGTTTGACGCAGCTAGATTTGAGCATAAACTTATTTCAAGGCCAGATTCCCCTCGGCAT

Reverse complement sequence

ATGCCGAGGGGAATCTGGCCTTGAAATAAGTTTATGCTCAAATCTAGCTGCGTCAAACTGGAACAGTTTGTAAGCGTGTCCGGAATGATCCCGTCCAAAA[T/A]
ATTGTTACTCAGGTTGAGGACTTGCAATTTTCGGAGACTGTTCAGGCGAGGTATCTGCCCAGAGAAGCGATTACCAGAAAGGTCAAGCAGGTGAAGGTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	15.00%	1.04%	15.68%	NA
All Indica	2759	60.80%	14.20%	1.67%	23.31%	NA
All Japonica	1512	94.20%	4.20%	0.00%	1.59%	NA
Aus	269	14.10%	66.20%	0.74%	18.96%	NA
Indica I	595	84.40%	0.50%	1.85%	13.28%	NA
Indica II	465	68.20%	21.10%	0.22%	10.54%	NA
Indica III	913	42.50%	17.70%	2.08%	37.68%	NA
Indica Intermediate	786	59.90%	16.40%	1.91%	21.76%	NA
Temperate Japonica	767	93.20%	5.90%	0.00%	0.91%	NA
Tropical Japonica	504	95.20%	2.20%	0.00%	2.58%	NA
Japonica Intermediate	241	95.40%	2.90%	0.00%	1.66%	NA
VI/Aromatic	96	12.50%	67.70%	0.00%	19.79%	NA
Intermediate	90	80.00%	14.40%	1.11%	4.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223953316	A -> T	LOC_Os02g39660.1	missense_variant ; p.Ile131Phe; MODERATE	nonsynonymous_codon ; I131L	Average:65.534; most accessible tissue: Callus, score: 79.908	benign	-0.427	TOLERATED	0.65
vg0223953316	A -> T	LOC_Os02g39660.1	missense_variant ; p.Ile131Phe; MODERATE	nonsynonymous_codon ; I131F	Average:65.534; most accessible tissue: Callus, score: 79.908	benign	0.378	TOLERATED	0.70
vg0223953316	A -> DEL	LOC_Os02g39660.1	N	frameshift_variant	Average:65.534; most accessible tissue: Callus, score: 79.908	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223953316	NA	4.34E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	NA	3.26E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	NA	3.95E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	NA	3.12E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	NA	1.67E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	7.45E-06	2.57E-09	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	8.95E-06	3.09E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	7.09E-06	NA	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	NA	2.98E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953316	5.96E-06	NA	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0223953316:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact