RiceVarMap2

Detailed information for vg0223953241:

Variant ID: vg0223953241 (JBrowse)

Variation Type: SNP

Chromosome: chr02

Position: 23953241

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGCGTCACGGCGCTCGAGCTCGCCGGCCAGAACTTGACCGGTCGACTCGCCGCCGCTTCTCTCGGGAATCTGAGTTACCTTCACCTGCTTGACCTTTCT[G/A]
GTAATCGCTTCTCTGGGCAGATACCTCGCCTGAACAGTCTCCGAAAATTGCAAGTCCTCAACCTGAGTAACAATATTTTGGACGGGATCATTCCGGACAC

Reverse complement sequence

GTGTCCGGAATGATCCCGTCCAAAATATTGTTACTCAGGTTGAGGACTTGCAATTTTCGGAGACTGTTCAGGCGAGGTATCTGCCCAGAGAAGCGATTAC[C/T]
AGAAAGGTCAAGCAGGTGAAGGTAACTCAGATTCCCGAGAGAAGCGGCGGCGAGTCGACCGGTCAAGTTCTGGCCGGCGAGCTCGAGCGCCGTGACGCGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	1.70%	0.59%	15.93%	NA
All Indica	2759	72.80%	2.30%	0.94%	23.99%	NA
All Japonica	1512	98.30%	0.10%	0.07%	1.46%	NA
Aus	269	82.90%	0.00%	0.37%	16.73%	NA
Indica I	595	85.20%	0.00%	0.67%	14.12%	NA
Indica II	465	80.20%	9.20%	0.22%	10.32%	NA
Indica III	913	60.20%	0.00%	1.64%	38.12%	NA
Indica Intermediate	786	73.50%	2.50%	0.76%	23.16%	NA
Temperate Japonica	767	99.10%	0.00%	0.13%	0.78%	NA
Tropical Japonica	504	97.20%	0.40%	0.00%	2.38%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	72.90%	7.30%	0.00%	19.79%	NA
Intermediate	90	84.40%	10.00%	0.00%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223953241	G -> A	LOC_Os02g39660.1	missense_variant ; p.Gly106Ser; MODERATE	nonsynonymous_codon ; G106S	Average:66.93; most accessible tissue: Callus, score: 79.908	benign	0.227	TOLERATED	0.98
vg0223953241	G -> DEL	LOC_Os02g39660.1	N	frameshift_variant	Average:66.93; most accessible tissue: Callus, score: 79.908	N	N	N	N

Showing 1 to 2 of 2 entries

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0223953241:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact