RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0223953106:

Variant ID: vg0223953106 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23953106
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

AAACGACTCCGACATGCTCGCGCTGCTCGAGTTCAAGGATGCCATCGGCGACGATCCGGCGGGCGTCCTGAGCTCCTGGAACAAAACCACCCCTTTCTGC[C/T]
GGTGGAATGGCGTGAAATGCGGCCGCCGGGAGCATCGCGTCACGGCGCTCGAGCTCGCCGGCCAGAACTTGACCGGTCGACTCGCCGCCGCTTCTCTCGG

Reverse complement sequence

CCGAGAGAAGCGGCGGCGAGTCGACCGGTCAAGTTCTGGCCGGCGAGCTCGAGCGCCGTGACGCGATGCTCCCGGCGGCCGCATTTCACGCCATTCCACC[G/A]
GCAGAAAGGGGTGGTTTTGTTCCAGGAGCTCAGGACGCCCGCCGGATCGTCGCCGATGGCATCCTTGAACTCGAGCAGCGCGAGCATGTCGGAGTCGTTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	13.70%	0.47%	16.36%	NA
All Indica	2759	60.80%	13.90%	0.76%	24.54%	NA
All Japonica	1512	97.60%	0.90%	0.00%	1.52%	NA
Aus	269	14.90%	66.20%	0.37%	18.59%	NA
Indica I	595	84.40%	0.50%	0.00%	15.13%	NA
Indica II	465	68.60%	21.10%	0.65%	9.68%	NA
Indica III	913	42.70%	17.30%	0.99%	38.99%	NA
Indica Intermediate	786	59.30%	15.90%	1.15%	23.66%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	95.60%	2.00%	0.00%	2.38%	NA
Japonica Intermediate	241	97.10%	1.20%	0.00%	1.66%	NA
VI/Aromatic	96	18.80%	62.50%	0.00%	18.75%	NA
Intermediate	90	80.00%	14.40%	0.00%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223953106	C -> T	LOC_Os02g39660.1	missense_variant ; p.Arg61Trp; MODERATE	nonsynonymous_codon ; R61W	Average:69.919; most accessible tissue: Zhenshan97 young leaf, score: 86.698	probably damaging	3.364	TOLERATED	0.07
vg0223953106	C -> DEL	LOC_Os02g39660.1	N	frameshift_variant	Average:69.919; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223953106	NA	5.32E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	NA	3.89E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	NA	4.36E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	NA	2.68E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	NA	1.90E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	8.18E-06	3.05E-09	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	9.98E-06	3.69E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	NA	3.76E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223953106	7.35E-06	NA	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0223953106:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact