RiceVarMap2

Detailed information for vg0223952998:

Variant ID: vg0223952998 (JBrowse)

Variation Type: SNP

Chromosome: chr02

Position: 23952998

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTTTACCACTGTGCAGGTAGCTCGCCATGCTCGTAGCTTTGTTTGCGGCGTTAGTACTCCTCTGCTACTCAGCCGGCAACATCCACTGCGTCGTGGCG[G/A]
TCCATGGAAACGACTCCGACATGCTCGCGCTGCTCGAGTTCAAGGATGCCATCGGCGACGATCCGGCGGGCGTCCTGAGCTCCTGGAACAAAACCACCCC

Reverse complement sequence

GGGGTGGTTTTGTTCCAGGAGCTCAGGACGCCCGCCGGATCGTCGCCGATGGCATCCTTGAACTCGAGCAGCGCGAGCATGTCGGAGTCGTTTCCATGGA[C/T]
CGCCACGACGCAGTGGATGTTGCCGGCTGAGTAGCAGAGGAGTACTAACGCCGCAAACAAAGCTACGAGCATGGCGAGCTACCTGCACAGTGGTAAAGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	13.60%	0.40%	16.38%	NA
All Indica	2759	61.10%	13.80%	0.62%	24.47%	NA
All Japonica	1512	97.60%	0.90%	0.00%	1.59%	NA
Aus	269	14.10%	66.20%	0.74%	18.96%	NA
Indica I	595	84.00%	0.50%	0.17%	15.29%	NA
Indica II	465	68.80%	20.60%	0.00%	10.54%	NA
Indica III	913	43.40%	17.20%	0.99%	38.44%	NA
Indica Intermediate	786	59.80%	15.90%	0.89%	23.41%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	95.40%	2.00%	0.00%	2.58%	NA
Japonica Intermediate	241	97.10%	1.20%	0.00%	1.66%	NA
VI/Aromatic	96	17.70%	62.50%	0.00%	19.79%	NA
Intermediate	90	80.00%	14.40%	0.00%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223952998	G -> A	LOC_Os02g39660.1	missense_variant ; p.Val25Ile; MODERATE	nonsynonymous_codon ; V25I	Average:78.664; most accessible tissue: Callus, score: 91.84	unknown	unknown	TOLERATED	0.28
vg0223952998	G -> DEL	LOC_Os02g39660.1	N	frameshift_variant	Average:78.664; most accessible tissue: Callus, score: 91.84	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223952998	NA	5.56E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223952998	9.76E-06	1.53E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223952998	NA	1.82E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0223952998:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact