| Variant ID: vg0223952991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23952991 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )
TATTTCTTGCTTTACCACTGTGCAGGTAGCTCGCCATGCTCGTAGCTTTGTTTGCGGCGTTAGTACTCCTCTGCTACTCAGCCGGCAACATCCACTGCGT[C/T]
GTGGCGGTCCATGGAAACGACTCCGACATGCTCGCGCTGCTCGAGTTCAAGGATGCCATCGGCGACGATCCGGCGGGCGTCCTGAGCTCCTGGAACAAAA
TTTTGTTCCAGGAGCTCAGGACGCCCGCCGGATCGTCGCCGATGGCATCCTTGAACTCGAGCAGCGCGAGCATGTCGGAGTCGTTTCCATGGACCGCCAC[G/A]
ACGCAGTGGATGTTGCCGGCTGAGTAGCAGAGGAGTACTAACGCCGCAAACAAAGCTACGAGCATGGCGAGCTACCTGCACAGTGGTAAAGCAAGAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 14.10% | 0.57% | 16.17% | NA |
| All Indica | 2759 | 51.30% | 23.70% | 0.94% | 24.10% | NA |
| All Japonica | 1512 | 97.90% | 0.50% | 0.00% | 1.59% | NA |
| Aus | 269 | 80.70% | 0.00% | 0.00% | 19.33% | NA |
| Indica I | 595 | 22.20% | 62.50% | 0.17% | 15.13% | NA |
| Indica II | 465 | 68.80% | 20.60% | 0.00% | 10.54% | NA |
| Indica III | 913 | 57.30% | 3.50% | 1.20% | 38.01% | NA |
| Indica Intermediate | 786 | 56.00% | 19.50% | 1.78% | 22.77% | NA |
| Temperate Japonica | 767 | 98.70% | 0.40% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 96.60% | 0.80% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 81.20% | 0.00% | 0.00% | 18.75% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223952991 | C -> T | LOC_Os02g39660.1 | synonymous_variant ; p.Val22Val; LOW | synonymous_codon | Average:78.798; most accessible tissue: Callus, score: 91.84 | N | N | N | N |
| vg0223952991 | C -> DEL | LOC_Os02g39660.1 | N | frameshift_variant | Average:78.798; most accessible tissue: Callus, score: 91.84 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223952991 | NA | 2.58E-13 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 1.55E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 6.45E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 6.97E-08 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 4.17E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 2.16E-08 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 6.50E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 3.66E-07 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 4.16E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223952991 | NA | 1.36E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/