Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223610511:

Variant ID: vg0223610511 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23610511
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCCGGCGACCTCCGCGCACTTGTGCCTCGCCGCGGCGCGGGAGATGGCCTTGAGCGCCATGGGATCCTCGTCCGCCGTCGCCGACACCGCCGCGGCGG[C/T]
GCCGCCGGCGGGCACGACGTGGAAGACGACGCCCCTGGCGCCGCGGCCGAGCACGGAGAGGGCCTTGAGGTCGGCGAGGCTCAGCTGCGGCGGCAGCGGC

Reverse complement sequence

GCCGCTGCCGCCGCAGCTGAGCCTCGCCGACCTCAAGGCCCTCTCCGTGCTCGGCCGCGGCGCCAGGGGCGTCGTCTTCCACGTCGTGCCCGCCGGCGGC[G/A]
CCGCCGCGGCGGTGTCGGCGACGGCGGACGAGGATCCCATGGCGCTCAAGGCCATCTCCCGCGCCGCGGCGAGGCACAAGTGCGCGGAGGTCGCCGGCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	8.80%	1.88%	0.72%	NA
All Indica	2759	89.80%	9.50%	0.43%	0.29%	NA
All Japonica	1512	92.60%	0.90%	4.96%	1.59%	NA
Aus	269	63.20%	36.40%	0.37%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	73.10%	24.70%	0.65%	1.51%	NA
Indica III	913	93.30%	6.50%	0.22%	0.00%	NA
Indica Intermediate	786	88.30%	11.10%	0.51%	0.13%	NA
Temperate Japonica	767	87.90%	0.00%	9.39%	2.74%	NA
Tropical Japonica	504	97.40%	2.00%	0.20%	0.40%	NA
Japonica Intermediate	241	97.50%	1.20%	0.83%	0.41%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	90.00%	6.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223610511	C -> T	LOC_Os02g39090.1	missense_variant ; p.Ala45Thr; MODERATE	nonsynonymous_codon ; A45T	Average:88.046; most accessible tissue: Minghui63 panicle, score: 95.282	unknown	unknown	TOLERATED	0.32
vg0223610511	C -> DEL	LOC_Os02g39090.1	N	frameshift_variant	Average:88.046; most accessible tissue: Minghui63 panicle, score: 95.282	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0223610511	C	T	-0.01	-0.01	-0.02	-0.01	0.0	0.0