Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222980080:

Variant ID: vg0222980080 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22980080
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GAATTGTTTTTGCATTTTTTTTTTAAGATCACGCATGTTTATTTTTGATATCATGATTATTGAACACGAATGAATTATGAGCATAGAGGAGTCAAATATG[G/T]
TATAAAAAAGAAATCATTTTCTTCCAACTACGAAATTGCGCAATATGCTAGTAAAACTGAATGTGGTGATGTGGTCCATTCAAGAATTTCTGGTTTACAG

Reverse complement sequence

CTGTAAACCAGAAATTCTTGAATGGACCACATCACCACATTCAGTTTTACTAGCATATTGCGCAATTTCGTAGTTGGAAGAAAATGATTTCTTTTTTATA[C/A]
CATATTTGACTCCTCTATGCTCATAATTCATTCGTGTTCAATAATCATGATATCAAAAATAAACATGCGTGATCTTAAAAAAAAAATGCAAAAACAATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	3.80%	0.00%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	49.10%	50.90%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222980080	G -> T	LOC_Os02g38029.1	upstream_gene_variant ; 3444.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38020.1	downstream_gene_variant ; 4784.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.1	downstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38020.2	downstream_gene_variant ; 4784.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.4	downstream_gene_variant ; 1753.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.3	downstream_gene_variant ; 1753.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.5	downstream_gene_variant ; 1753.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.6	downstream_gene_variant ; 1753.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38050.2	downstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0222980080	G -> T	LOC_Os02g38040.1	intron_variant ; MODIFIER	silent_mutation	Average:47.489; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N