| Variant ID: vg0222979709 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 22979709 |
| Reference Allele: AT | Alternative Allele: A |
| Primary Allele: AT | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGTCCTCGACGTCTCGCGAAATCAGCTCAAGGTATTATTAATTGCTGATTTGTTTCTGTCATTTTCTGTGGTTATCGATCGCCAACCTGCAAAACCTGC[AT/A]
TGCGTTGCGCGGTTGCGTTCGCGGATCACGAGTTCACGTCGTTTCAGATTTAGAAATTAGAAGAACTGTTCGTCCGATCCGGGGAATTCGGGTGATAGGG
CCCTATCACCCGAATTCCCCGGATCGGACGAACAGTTCTTCTAATTTCTAAATCTGAAACGACGTGAACTCGTGATCCGCGAACGCAACCGCGCAACGCA[AT/T]
GCAGGTTTTGCAGGTTGGCGATCGATAACCACAGAAAATGACAGAAACAAATCAGCAATTAATAATACCTTGAGCTGATTTCGCGAGACGTCGAGGACGA
| Populations | Population Size | Frequency of AT(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222979709 | AT -> A | LOC_Os02g38029.1 | upstream_gene_variant ; 3074.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38020.1 | downstream_gene_variant ; 4414.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.1 | downstream_gene_variant ; 2136.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38020.2 | downstream_gene_variant ; 4414.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.4 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.3 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.5 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.6 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38050.2 | downstream_gene_variant ; 2136.0bp to feature; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |
| vg0222979709 | AT -> A | LOC_Os02g38040.1 | intron_variant ; MODIFIER | silent_mutation | Average:72.31; most accessible tissue: Callus, score: 87.432 | N | N | N | N |