Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221476188:

Variant ID: vg0221476188 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21476188
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCCGTTGCGCCCAGTTCAGAACCGGGCCGGGCTCCGCGCCCTGGACTCCCTTCTTACCTGCATCACATCCAAAACCATTAATTAGCTTAGCCCTACG[T/C]
GTGGAGATTTTTTGGCTCCGCCCCCTGATCACATGGGCGTAAACTTGTCGGGATTTTACTGTTGCTCTTTATCTCGTGTTTGCTTTAAATTTGGGAGTGT

Reverse complement sequence

ACACTCCCAAATTTAAAGCAAACACGAGATAAAGAGCAACAGTAAAATCCCGACAAGTTTACGCCCATGTGATCAGGGGGCGGAGCCAAAAAATCTCCAC[A/G]
CGTAGGGCTAAGCTAATTAATGGTTTTGGATGTGATGCAGGTAAGAAGGGAGTCCAGGGCGCGGAGCCCGGCCCGGTTCTGAACTGGGCGCAACGGGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.50% 0.06% 0.08% NA
All Indica  2759 98.20% 1.60% 0.07% 0.11% NA
All Japonica  1512 3.90% 96.00% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.00% 0.17% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 98.50% 1.30% 0.11% 0.11% NA
Indica Intermediate  786 98.00% 1.90% 0.00% 0.13% NA
Temperate Japonica  767 1.60% 98.30% 0.00% 0.13% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221476188 T -> DEL N N silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0221476188 T -> C LOC_Os02g35750.1 downstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0221476188 T -> C LOC_Os02g35750.2 downstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0221476188 T -> C LOC_Os02g35750.3 downstream_gene_variant ; 555.0bp to feature; MODIFIER silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0221476188 T -> C LOC_Os02g35760.1 intron_variant ; MODIFIER silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0221476188 T -> C LOC_Os02g35760.2 intron_variant ; MODIFIER silent_mutation Average:77.021; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221476188 T C 0.04 0.04 0.02 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221476188 NA 1.04E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 1.99E-65 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 4.10E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 5.55E-82 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 3.34E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 1.72E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 7.86E-90 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 7.36E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 1.10E-33 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 2.53E-84 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 7.16E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 7.88E-59 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 1.11E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 2.46E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 4.00E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 3.32E-06 3.32E-06 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 2.34E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 2.44E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 2.90E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221476188 NA 1.59E-06 mr1911_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251