Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221475627:

Variant ID: vg0221475627 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21475627
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCACAAAGATCATGGTATATGTAAGATCATTGGAAATGGAAAGATTGAAATAGGATATATTGTAATAAGTTATCTTTTGTTGAAGGATAAAACTTCTC[C/A]
TTACCCAAGTGACAAGACTTTGTTGCCCTTTTGGCATGGTGTGATCAACTGGTTTCCTTCCGGTTAGTAGCTCCAATAGAATCACGCCAAAGCTGTAAAC

Reverse complement sequence

GTTTACAGCTTTGGCGTGATTCTATTGGAGCTACTAACCGGAAGGAAACCAGTTGATCACACCATGCCAAAAGGGCAACAAAGTCTTGTCACTTGGGTAA[G/T]
GAGAAGTTTTATCCTTCAACAAAAGATAACTTATTACAATATATCCTATTTCAATCTTTCCATTTCCAATGATCTTACATATACCATGATCTTTGTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	34.60%	0.02%	0.11%	NA
All Indica	2759	98.20%	1.60%	0.00%	0.14%	NA
All Japonica	1512	3.80%	96.20%	0.00%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.00%	0.17%	NA
Indica II	465	97.80%	1.90%	0.00%	0.22%	NA
Indica III	913	98.50%	1.40%	0.00%	0.11%	NA
Indica Intermediate	786	98.00%	1.90%	0.00%	0.13%	NA
Temperate Japonica	767	1.40%	98.40%	0.00%	0.13%	NA
Tropical Japonica	504	6.90%	93.10%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221475627	C -> A	LOC_Os02g35760.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> A	LOC_Os02g35760.2	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> A	LOC_Os02g35750.3	3_prime_UTR_variant ; 2206.0bp to feature; MODIFIER	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> A	LOC_Os02g35740.1	upstream_gene_variant ; 4491.0bp to feature; MODIFIER	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> A	LOC_Os02g35750.1	downstream_gene_variant ; 1805.0bp to feature; MODIFIER	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> A	LOC_Os02g35750.2	downstream_gene_variant ; 159.0bp to feature; MODIFIER	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0221475627	C -> DEL	N	N	silent_mutation	Average:68.464; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221475627	NA	1.04E-71	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	1.99E-65	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	4.10E-11	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	5.55E-82	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	3.34E-76	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	1.72E-23	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	7.86E-90	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	7.36E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	1.10E-33	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	2.53E-84	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	7.16E-36	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	7.88E-59	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	1.11E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	2.46E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	4.00E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	3.32E-06	3.32E-06	mr1918	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	2.34E-100	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	2.44E-12	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	2.90E-17	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475627	NA	1.59E-06	mr1911_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251