Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221475461:

Variant ID: vg0221475461 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21475461
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATCATGAAAGAAAAAACAATGGCACTCACTGCTGCTTTCTGAATTTTGTCAGATTTGCTACAGTATAGCTACCTTTGCGACAGCCTTCGGAGGGTA[A/G]
TCATTGTTGAGCTTTGGATCGACGCACTGCTTAACTTTATCTTCGCTCAATCTTGGAGTAGCCTGCCTCACAAAGATCATGGTATATGTAAGATCATTGG

Reverse complement sequence

CCAATGATCTTACATATACCATGATCTTTGTGAGGCAGGCTACTCCAAGATTGAGCGAAGATAAAGTTAAGCAGTGCGTCGATCCAAAGCTCAACAATGA[T/C]
TACCCTCCGAAGGCTGTCGCAAAGGTAGCTATACTGTAGCAAATCTGACAAAATTCAGAAAGCAGCAGTGAGTGCCATTGTTTTTTCTTTCATGATTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.60% 0.00% 0.13% NA
All Indica  2759 98.20% 1.60% 0.00% 0.14% NA
All Japonica  1512 3.80% 96.20% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 98.50% 1.40% 0.00% 0.11% NA
Indica Intermediate  786 98.00% 1.90% 0.00% 0.13% NA
Temperate Japonica  767 1.40% 98.40% 0.00% 0.13% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221475461 A -> G LOC_Os02g35760.1 synonymous_variant ; p.Asp312Asp; LOW synonymous_codon Average:64.351; most accessible tissue: Callus, score: 83.659 N N N N
vg0221475461 A -> G LOC_Os02g35760.2 synonymous_variant ; p.Asp312Asp; LOW synonymous_codon Average:64.351; most accessible tissue: Callus, score: 83.659 N N N N
vg0221475461 A -> DEL LOC_Os02g35760.1 N frameshift_variant Average:64.351; most accessible tissue: Callus, score: 83.659 N N N N
vg0221475461 A -> DEL LOC_Os02g35760.2 N frameshift_variant Average:64.351; most accessible tissue: Callus, score: 83.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221475461 NA 1.04E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 1.99E-65 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 4.10E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 5.55E-82 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 3.34E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 1.72E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 7.86E-90 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 7.36E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 1.10E-33 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 2.53E-84 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 7.16E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 7.88E-59 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 1.11E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 2.46E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 4.00E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 3.32E-06 3.32E-06 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 2.34E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 2.44E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 2.90E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221475461 NA 1.59E-06 mr1911_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251