| Variant ID: vg0221475404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21475404 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 281. )
CGGTCGGAAGTCGGCTTCGTACTGAACGCACAATGCTGCAACTGCTGCTAGCTGAAAAAAAATCATGAAAGAAAAAACAATGGCACTCACTGCTGCTTTC[T/C]
GAATTTTGTCAGATTTGCTACAGTATAGCTACCTTTGCGACAGCCTTCGGAGGGTAATCATTGTTGAGCTTTGGATCGACGCACTGCTTAACTTTATCTT
AAGATAAAGTTAAGCAGTGCGTCGATCCAAAGCTCAACAATGATTACCCTCCGAAGGCTGTCGCAAAGGTAGCTATACTGTAGCAAATCTGACAAAATTC[A/G]
GAAAGCAGCAGTGAGTGCCATTGTTTTTTCTTTCATGATTTTTTTTCAGCTAGCAGCAGTTGCAGCATTGTGCGTTCAGTACGAAGCCGACTTCCGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 43.00% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 92.50% | 7.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.70% | 9.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.30% | 9.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221475404 | T -> C | LOC_Os02g35750.2 | 3_prime_UTR_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| vg0221475404 | T -> C | LOC_Os02g35750.3 | 3_prime_UTR_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| vg0221475404 | T -> C | LOC_Os02g35740.1 | upstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| vg0221475404 | T -> C | LOC_Os02g35750.1 | downstream_gene_variant ; 1582.0bp to feature; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| vg0221475404 | T -> C | LOC_Os02g35760.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| vg0221475404 | T -> C | LOC_Os02g35760.2 | intron_variant ; MODIFIER | silent_mutation | Average:67.431; most accessible tissue: Minghui63 flower, score: 81.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221475404 | NA | 8.66E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 3.53E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 1.17E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 3.38E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | 3.32E-06 | 3.32E-06 | mr1918 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 6.80E-31 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 9.63E-58 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 7.54E-45 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 5.79E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 8.59E-16 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221475404 | NA | 1.59E-06 | mr1911_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |