Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221474990:

Variant ID: vg0221474990 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21474990
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAAGAGGCAGCCATGGAAGTTCTTGGGAATGCATCATGCAATCCTTGGTTCTATGCAAGCTTTTGAAGGACCTTAAAATTACACCATGACACGACA[A/T]
AGAATAACTTAATTCATTACACCAGTTAGCAAAATACCCCCTCTATATGTAATATACCCTGTGGTACCAATGGATCAGTGTTTTACAAAAAATCATGCCG

Reverse complement sequence

CGGCATGATTTTTTGTAAAACACTGATCCATTGGTACCACAGGGTATATTACATATAGAGGGGGTATTTTGCTAACTGGTGTAATGAATTAAGTTATTCT[T/A]
TGTCGTGTCATGGTGTAATTTTAAGGTCCTTCAAAAGCTTGCATAGAACCAAGGATTGCATGATGCATTCCCAAGAACTTCCATGGCTGCCTCTTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.00%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221474990	A -> T	LOC_Os02g35760.1	3_prime_UTR_variant ; 233.0bp to feature; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N
vg0221474990	A -> T	LOC_Os02g35750.2	3_prime_UTR_variant ; 1569.0bp to feature; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N
vg0221474990	A -> T	LOC_Os02g35760.2	3_prime_UTR_variant ; 233.0bp to feature; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N
vg0221474990	A -> T	LOC_Os02g35740.1	upstream_gene_variant ; 3854.0bp to feature; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N
vg0221474990	A -> T	LOC_Os02g35750.1	downstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N
vg0221474990	A -> T	LOC_Os02g35750.3	intron_variant ; MODIFIER	silent_mutation	Average:51.599; most accessible tissue: Callus, score: 84.947	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221474990	NA	1.59E-12	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474990	NA	5.72E-20	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474990	NA	1.77E-09	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474990	NA	8.03E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474990	NA	7.42E-22	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474990	NA	1.40E-10	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251