Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221474880:

Variant ID: vg0221474880 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21474880
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGCCAAAACCTGAATTCAGGAACAGGATTTTAGCCCCAGCTTTGTAGTTCCAACAGAAAAAAAGAAGAAGAAAAACTACTATTAATTCCAAAGTTCTA[T/C]
ACAAATATAAGAAAAAGAGGCAGCCATGGAAGTTCTTGGGAATGCATCATGCAATCCTTGGTTCTATGCAAGCTTTTGAAGGACCTTAAAATTACACCAT

Reverse complement sequence

ATGGTGTAATTTTAAGGTCCTTCAAAAGCTTGCATAGAACCAAGGATTGCATGATGCATTCCCAAGAACTTCCATGGCTGCCTCTTTTTCTTATATTTGT[A/G]
TAGAACTTTGGAATTAATAGTAGTTTTTCTTCTTCTTTTTTTCTGTTGGAACTACAAAGCTGGGGCTAAAATCCTGTTCCTGAATTCAGGTTTTGGCCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	42.90%	0.04%	0.00%	NA
All Indica	2759	92.60%	7.30%	0.07%	0.00%	NA
All Japonica	1512	3.60%	96.40%	0.00%	0.00%	NA
Aus	269	15.60%	84.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.70%	0.17%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	90.50%	9.40%	0.13%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	6.70%	93.30%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221474880	T -> C	LOC_Os02g35760.1	3_prime_UTR_variant ; 343.0bp to feature; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0221474880	T -> C	LOC_Os02g35750.2	3_prime_UTR_variant ; 1459.0bp to feature; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0221474880	T -> C	LOC_Os02g35760.2	3_prime_UTR_variant ; 343.0bp to feature; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0221474880	T -> C	LOC_Os02g35740.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0221474880	T -> C	LOC_Os02g35750.1	downstream_gene_variant ; 1058.0bp to feature; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0221474880	T -> C	LOC_Os02g35750.3	intron_variant ; MODIFIER	silent_mutation	Average:53.875; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221474880	NA	6.26E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	3.70E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	2.23E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	6.03E-06	6.03E-06	mr1918	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	1.67E-56	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	2.57E-45	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	8.05E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	2.50E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221474880	NA	5.62E-06	mr1911_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251