Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208367670:

Variant ID: vg0208367670 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8367670
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGGCGGCTGCTCGTACGCGGGGATGTCGTCCGCCGTCGCCACCCGCGCGCCTCCGCCTCCGCGCACGGTCGGCGTCTCCCGTGGCTGCACGCCGTCGC[G/C]
CAGGTGGCTCGGCAGGCCATCGCCGCCGCCGCCGTTCCGGCGCGGGAGCAGCGCGCGCGCGCACCGGGAGAGCGCGTCCCGGACAGGAGCCAGCGGGCGC

Reverse complement sequence

GCGCCCGCTGGCTCCTGTCCGGGACGCGCTCTCCCGGTGCGCGCGCGCGCTGCTCCCGCGCCGGAACGGCGGCGGCGGCGATGGCCTGCCGAGCCACCTG[C/G]
GCGACGGCGTGCAGCCACGGGAGACGCCGACCGTGCGCGGAGGCGGAGGCGCGCGGGTGGCGACGGCGGACGACATCCCCGCGTACGAGCAGCCGCCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 16.90% 5.95% 1.31% NA
All Indica  2759 96.30% 3.10% 0.43% 0.14% NA
All Japonica  1512 34.10% 44.80% 17.26% 3.84% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.80% 1.50% 0.50% 0.17% NA
Indica II  465 98.50% 1.10% 0.43% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 8.40% 0.89% 0.38% NA
Temperate Japonica  767 21.90% 41.30% 30.25% 6.52% NA
Tropical Japonica  504 60.50% 38.30% 1.19% 0.00% NA
Japonica Intermediate  241 17.40% 69.70% 9.54% 3.32% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 71.10% 20.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208367670 G -> DEL LOC_Os02g15000.1 N frameshift_variant Average:89.548; most accessible tissue: Zhenshan97 flag leaf, score: 97.647 N N N N
vg0208367670 G -> C LOC_Os02g15000.1 missense_variant ; p.Arg107Gly; MODERATE nonsynonymous_codon ; R107G Average:89.548; most accessible tissue: Zhenshan97 flag leaf, score: 97.647 unknown unknown TOLERATED 0.42

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208367670 G C 0.0 0.0 -0.01 0.0 0.0 -0.01