Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207045692:

Variant ID: vg0207045692 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7045692
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGAGCTGCGACGGCTGGATCTTGTTGACAGCGGCCATGGTGACGGCGGCGGAGGCCAGGAGGACCCCCGCGGATGCCTTGAGCGCCACGACGGTCGG[C/A,T]
GCGGCGGGCGCGAGCGCGGCCATGACGGAGGCGGCGAGGGCGAGGGAGTTGTTGGAGTGGAGCAGCAGGTGGTTCCAGTTGTCCCGCTGCCTCCCGATGA

Reverse complement sequence

TCATCGGGAGGCAGCGGGACAACTGGAACCACCTGCTGCTCCACTCCAACAACTCCCTCGCCCTCGCCGCCTCCGTCATGGCCGCGCTCGCGCCCGCCGC[G/T,A]
CCGACCGTCGTGGCGCTCAAGGCATCCGCGGGGGTCCTCCTGGCCTCCGCCGCCGTCACCATGGCCGCTGTCAACAAGATCCAGCCGTCGCAGCTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.80% 0.34% 0.00% T: 0.02%
All Indica  2759 37.90% 61.60% 0.51% 0.00% T: 0.04%
All Japonica  1512 97.20% 2.80% 0.07% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 50.80% 48.90% 0.34% 0.00% NA
Indica II  465 19.60% 79.60% 0.86% 0.00% NA
Indica III  913 31.40% 68.00% 0.44% 0.00% T: 0.11%
Indica Intermediate  786 46.40% 53.10% 0.51% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.80% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207045692 C -> A LOC_Os02g13220.1 synonymous_variant ; p.Ala137Ala; LOW synonymous_codon Average:86.595; most accessible tissue: Zhenshan97 flower, score: 94.209 N N N N
vg0207045692 C -> T LOC_Os02g13220.1 synonymous_variant ; p.Ala137Ala; LOW synonymous_codon Average:86.595; most accessible tissue: Zhenshan97 flower, score: 94.209 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207045692 C A 0.0 0.0 -0.01 -0.01 -0.01 -0.02
vg0207045692 C T 0.01 0.01 0.02 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207045692 NA 3.95E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045692 NA 2.95E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045692 NA 1.74E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045692 NA 4.28E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251