Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207045689:

Variant ID: vg0207045689 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 7045689
Reference Allele: CGGCGCGGCG	Alternative Allele: GGGCGCGGCG,C
Primary Allele: CGGCGCGGCG	Secondary Allele: GGGCGCGGCG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCGGCGAGCTGCGACGGCTGGATCTTGTTGACAGCGGCCATGGTGACGGCGGCGGAGGCCAGGAGGACCCCCGCGGATGCCTTGAGCGCCACGACGGT[CGGCGCGGCG/GGGCGCGGCG,C]
GGCGCGAGCGCGGCCATGACGGAGGCGGCGAGGGCGAGGGAGTTGTTGGAGTGGAGCAGCAGGTGGTTCCAGTTGTCCCGCTGCCTCCCGATGATGTCGT

Reverse complement sequence

ACGACATCATCGGGAGGCAGCGGGACAACTGGAACCACCTGCTGCTCCACTCCAACAACTCCCTCGCCCTCGCCGCCTCCGTCATGGCCGCGCTCGCGCC[CGCCGCGCCG/CGCCGCGCCC,G]
ACCGTCGTGGCGCTCAAGGCATCCGCGGGGGTCCTCCTGGCCTCCGCCGCCGTCACCATGGCCGCTGTCAACAAGATCCAGCCGTCGCAGCTCGCCGAGG

Allele Frequencies:

Populations	Population Size	Frequency of CGGCGCGGCG(primary allele)	Frequency of GGGCGCGGCG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	12.30%	0.04%	0.00%	C: 0.04%
All Indica	2759	82.40%	17.50%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.00%	0.00%	C: 0.13%
Aus	269	69.10%	30.90%	0.00%	0.00%	NA
Indica I	595	76.80%	23.20%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	87.50%	12.40%	0.11%	0.00%	NA
Indica Intermediate	786	75.80%	24.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.00%	C: 0.40%
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207045689	CGGCGCGGCG -> GGGCGCGGCG	LOC_Os02g13220.1	synonymous_variant ; p.Pro138Pro; LOW	synonymous_codon	Average:86.59; most accessible tissue: Zhenshan97 flower, score: 94.209	N	N	N	N
vg0207045689	CGGCGCGGCG -> C	LOC_Os02g13220.1	disruptive_inframe_deletion ; p.Ala136_Pro138del; MODERATE	inframe_variant	Average:86.59; most accessible tissue: Zhenshan97 flower, score: 94.209	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0207045689	CGGCG*	C	-0.18	-0.18	-0.23	-0.14	-0.22	-0.3
vg0207045689	CGGCG*	GGGCG*	0.0	0.02	0.03	0.02	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207045689	NA	1.39E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	2.45E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	6.82E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	6.38E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	4.05E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	9.53E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	4.36E-07	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207045689	NA	4.87E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251