Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205478035:

Variant ID: vg0205478035 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 5478035
Reference Allele: AGAlternative Allele: A
Primary Allele: AGSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATTGGCCTGGCCAGAATTAGCATGACATCACTATTATGTTTTTGCATTGCACCACCATTGCTGTGTAAAGTTCACTCAACTTTTTGTTGTTTTGACGG[AG/A]
GAAAAAAAAAGGATATTGCAGGCTGTATGATATTCTGAAAAGCAGGTGTTATTTCTGAATTTACAGTCTAACGAGTTACTGTTAAATTCATATGTTTATA

Reverse complement sequence

TATAAACATATGAATTTAACAGTAACTCGTTAGACTGTAAATTCAGAAATAACACCTGCTTTTCAGAATATCATACAGCCTGCAATATCCTTTTTTTTTC[CT/T]
CCGTCAAAACAACAAAAAGTTGAGTGAACTTTACACAGCAATGGTGGTGCAATGCAAAAACATAATAGTGATGTCATGCTAATTCTGGCCAGGCCAATGC

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 0.10% 4.87% 0.99% NA
All Indica  2759 95.00% 0.30% 4.17% 0.62% NA
All Japonica  1512 98.10% 0.00% 1.26% 0.60% NA
Aus  269 66.50% 0.00% 27.51% 5.95% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 85.80% 0.00% 13.33% 0.86% NA
Indica III  913 96.50% 0.80% 2.08% 0.66% NA
Indica Intermediate  786 95.00% 0.00% 4.07% 0.89% NA
Temperate Japonica  767 99.50% 0.00% 0.26% 0.26% NA
Tropical Japonica  504 95.60% 0.00% 2.98% 1.39% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 77.10% 0.00% 17.71% 5.21% NA
Intermediate  90 94.40% 0.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205478035 AG -> A LOC_Os02g10400.1 upstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> A LOC_Os02g10410.1 upstream_gene_variant ; 2078.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> A LOC_Os02g10440.1 upstream_gene_variant ; 4692.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> A LOC_Os02g10430.1 downstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> A LOC_Os02g10430.2 downstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> A LOC_Os02g10420.1 intron_variant ; MODIFIER silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N
vg0205478035 AG -> DEL N N silent_mutation Average:61.692; most accessible tissue: Zhenshan97 flower, score: 91.158 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205478035 AG A 0.09 0.03 0.01 0.03 0.06 0.08