Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205477743:

Variant ID: vg0205477743 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 5477743
Reference Allele: TAA	Alternative Allele: TAAA,AAA,T
Primary Allele: TAA	Secondary Allele: TAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTGCAGTTTTGTGCACAACGGTTGGTCATATTGGGAGATGGACTTTTGAAACAGATACTGCTCATTCCGTTTTATATTATAAAGCGTTTTGATTTTTTT[TAA/TAAA,AAA,T]
AATTTAAACTTTTTTAAGTTTGATTAAATTCGTAAAAAAAATATAGTAACAAACCTAAAGAATTTTGATTTAAAAAATCAAAACAAATTGTAATATGAGA

Reverse complement sequence

TCTCATATTACAATTTGTTTTGATTTTTTAAATCAAAATTCTTTAGGTTTGTTACTATATTTTTTTTACGAATTTAATCAAACTTAAAAAAGTTTAAATT[TTA/TTTA,TTT,A]
AAAAAAATCAAAACGCTTTATAATATAAAACGGAATGAGCAGTATCTGTTTCAAAAGTCCATCTCCCAATATGACCAACCGTTGTGCACAAAACTGCAGG

Allele Frequencies:

Populations	Population Size	Frequency of TAA(primary allele)	Frequency of TAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.00%	2.70%	0.15%	0.00%	AAA: 0.11%; T: 0.04%
All Indica	2759	95.40%	4.40%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	98.90%	0.40%	0.00%	0.00%	T: 0.74%
Indica I	595	95.30%	4.40%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	91.10%	8.70%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	1.04%	0.00%	AAA: 3.12%
Intermediate	90	92.20%	3.30%	2.22%	0.00%	AAA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205477743	TAA -> AAA	LOC_Os02g10400.1	upstream_gene_variant ; 2609.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> AAA	LOC_Os02g10410.1	upstream_gene_variant ; 1785.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> AAA	LOC_Os02g10440.1	upstream_gene_variant ; 4985.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> AAA	LOC_Os02g10430.1	downstream_gene_variant ; 955.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> AAA	LOC_Os02g10430.2	downstream_gene_variant ; 955.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> AAA	LOC_Os02g10420.1	intron_variant ; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10400.1	upstream_gene_variant ; 2610.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10410.1	upstream_gene_variant ; 1786.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10440.1	upstream_gene_variant ; 4984.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10430.1	downstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10430.2	downstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> T	LOC_Os02g10420.1	intron_variant ; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10400.1	upstream_gene_variant ; 2612.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10410.1	upstream_gene_variant ; 1788.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10440.1	upstream_gene_variant ; 4982.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10430.1	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10430.2	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N
vg0205477743	TAA -> TAAA	LOC_Os02g10420.1	intron_variant ; MODIFIER	silent_mutation	Average:52.295; most accessible tissue: Minghui63 flower, score: 86.369	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0205477743	TAA	AAA	0.01	0.01	0.0	0.0	0.01	0.01
vg0205477743	TAA	T	0.06	-0.05	-0.02	-0.11	-0.13	-0.08
vg0205477743	TAA	TAAA	-0.17	-0.18	-0.12	-0.14	-0.19	-0.18