Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205477465:

Variant ID: vg0205477465 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5477465
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCACCTTCTCCCGCGCCGCGTACCCGTGCGCCTCCTGGAACTCTACCGGCACGTTCTTTGAGATTGATCGAGAGGTTTAGCAACAACAATAAGACAGT[G/A]
GAAGGCAACTCGATCAAAATGGTGGCATAGGGTGGGTGTGCTGAACAAAGCGCCTGATCATCTCATGCCTCCTACGAAGTTCACTTCGTGAAATGAAGTG

Reverse complement sequence

CACTTCATTTCACGAAGTGAACTTCGTAGGAGGCATGAGATGATCAGGCGCTTTGTTCAGCACACCCACCCTATGCCACCATTTTGATCGAGTTGCCTTC[C/T]
ACTGTCTTATTGTTGTTGCTAAACCTCTCGATCAATCTCAAAGAACGTGCCGGTAGAGTTCCAGGAGGCGCACGGGTACGCGGCGCGGGAGAAGGTGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	21.00%	1.02%	0.02%	NA
All Indica	2759	88.80%	10.90%	0.33%	0.04%	NA
All Japonica	1512	73.70%	23.90%	2.38%	0.00%	NA
Aus	269	15.20%	84.40%	0.37%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	71.60%	28.20%	0.22%	0.00%	NA
Indica III	913	92.20%	7.70%	0.00%	0.11%	NA
Indica Intermediate	786	86.60%	12.50%	0.89%	0.00%	NA
Temperate Japonica	767	96.30%	2.20%	1.43%	0.00%	NA
Tropical Japonica	504	31.90%	63.90%	4.17%	0.00%	NA
Japonica Intermediate	241	88.80%	9.50%	1.66%	0.00%	NA
VI/Aromatic	96	26.00%	74.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205477465	G -> A	LOC_Os02g10400.1	upstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N
vg0205477465	G -> A	LOC_Os02g10410.1	upstream_gene_variant ; 1507.0bp to feature; MODIFIER	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N
vg0205477465	G -> A	LOC_Os02g10430.1	downstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N
vg0205477465	G -> A	LOC_Os02g10430.2	downstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N
vg0205477465	G -> A	LOC_Os02g10420.1	intron_variant ; MODIFIER	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N
vg0205477465	G -> DEL	N	N	silent_mutation	Average:87.637; most accessible tissue: Minghui63 flower, score: 92.871	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0205477465	G	A	-0.01	-0.01	0.01	0.0	0.0	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205477465	NA	2.07E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	4.97E-08	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	7.24E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	2.59E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	7.32E-12	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	3.17E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	4.34E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	3.91E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	6.46E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205477465	NA	1.11E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251