Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203137855:

Variant ID: vg0203137855 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3137855
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, A: 0.41, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCTTGAGGTTGATGATCTTGAGACTTGTAAAGTTGCTTAGAGATGATGGAAACACTCTGGACATCCTGTTGTTATCCAACTGGAGCTCCTCCAATCT[A/C]
TTAAGCTGACCTATGGAACCCGGAATATCACCGATGAAGTTGTTATGCTTGATGCCGATGATTTTGAGACTAGTACAGTTGCCTAGAGCTGATGGCAACT

Reverse complement sequence

AGTTGCCATCAGCTCTAGGCAACTGTACTAGTCTCAAAATCATCGGCATCAAGCATAACAACTTCATCGGTGATATTCCGGGTTCCATAGGTCAGCTTAA[T/G]
AGATTGGAGGAGCTCCAGTTGGATAACAACAGGATGTCCAGAGTGTTTCCATCATCTCTAAGCAACTTTACAAGTCTCAAGATCATCAACCTCAAGCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 42.80% 0.08% 2.24% NA
All Indica  2759 38.30% 59.20% 0.07% 2.46% NA
All Japonica  1512 90.50% 9.30% 0.00% 0.20% NA
Aus  269 17.10% 82.50% 0.00% 0.37% NA
Indica I  595 53.10% 46.90% 0.00% 0.00% NA
Indica II  465 53.30% 46.50% 0.00% 0.22% NA
Indica III  913 17.90% 77.90% 0.11% 4.16% NA
Indica Intermediate  786 41.90% 54.30% 0.13% 3.69% NA
Temperate Japonica  767 84.40% 15.60% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.00% 0.00% 1.24% NA
VI/Aromatic  96 64.60% 4.20% 0.00% 31.25% NA
Intermediate  90 65.60% 27.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203137855 A -> DEL LOC_Os02g06280.1 N frameshift_variant Average:82.052; most accessible tissue: Zhenshan97 flower, score: 95.064 N N N N
vg0203137855 A -> C LOC_Os02g06280.1 missense_variant ; p.Asn37Lys; MODERATE nonsynonymous_codon Average:82.052; most accessible tissue: Zhenshan97 flower, score: 95.064 possibly damaging -1.714 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0203137855 A C -0.04 -0.03 -0.02 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203137855 NA 1.09E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203137855 NA 5.89E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203137855 NA 1.19E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251