Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203137792:

Variant ID: vg0203137792 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3137792
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAAAGTTTCAGATTGGGCAGTCTGGAGAAGTTAACCTTCGAAAGCTCTCCTGTGAAGTTGTTGTGCTTGAGGTTGATGATCTTGAGACTTGTAAAGTT[G/T]
CTTAGAGATGATGGAAACACTCTGGACATCCTGTTGTTATCCAACTGGAGCTCCTCCAATCTATTAAGCTGACCTATGGAACCCGGAATATCACCGATGA

Reverse complement sequence

TCATCGGTGATATTCCGGGTTCCATAGGTCAGCTTAATAGATTGGAGGAGCTCCAGTTGGATAACAACAGGATGTCCAGAGTGTTTCCATCATCTCTAAG[C/A]
AACTTTACAAGTCTCAAGATCATCAACCTCAAGCACAACAACTTCACAGGAGAGCTTTCGAAGGTTAACTTCTCCAGACTGCCCAATCTGAAACTTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	14.40%	0.15%	2.18%	NA
All Indica	2759	73.30%	24.10%	0.14%	2.43%	NA
All Japonica	1512	99.20%	0.50%	0.07%	0.20%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	77.10%	22.70%	0.17%	0.00%	NA
Indica II	465	84.50%	15.30%	0.00%	0.22%	NA
Indica III	913	67.80%	27.90%	0.11%	4.16%	NA
Indica Intermediate	786	70.10%	26.10%	0.25%	3.56%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	68.80%	1.00%	1.04%	29.17%	NA
Intermediate	90	88.90%	5.60%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203137792	G -> T	LOC_Os02g06280.1	missense_variant ; p.Ser58Arg; MODERATE	nonsynonymous_codon ; S58R	Average:80.985; most accessible tissue: Zhenshan97 flower, score: 93.144	unknown	unknown	TOLERATED	0.33
vg0203137792	G -> DEL	LOC_Os02g06280.1	N	frameshift_variant	Average:80.985; most accessible tissue: Zhenshan97 flower, score: 93.144	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0203137792	G	T	-0.07	-0.05	-0.03	-0.04	-0.05	0.01