Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200789738:

Variant ID: vg0200789738 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 789738
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGTCTCCCATGTTTAGCAGGTCAAAGTAGCCGCCGCCTCCTGCCATTGGAGCAGCAGCAGCTGAGCTCTGATGCTGCTGCTGCAATGCGCCGTAGCT[G/A]
CCGCTCATCTGGTCCCCGAACGCGCCGCCGTGCGACGGCGTCACGTTGCCGGAGCTCGCCGTGGACGCCGGCCAGTGCTGCGCCGAGATGGAGTAGCTCT

Reverse complement sequence

AGAGCTACTCCATCTCGGCGCAGCACTGGCCGGCGTCCACGGCGAGCTCCGGCAACGTGACGCCGTCGCACGGCGGCGCGTTCGGGGACCAGATGAGCGG[C/T]
AGCTACGGCGCATTGCAGCAGCAGCATCAGAGCTCAGCTGCTGCTGCTCCAATGGCAGGAGGCGGCGGCTACTTTGACCTGCTAAACATGGGAGACATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.10% 0.04% 0.00% NA
All Indica  2759 95.10% 4.90% 0.00% 0.00% NA
All Japonica  1512 60.80% 39.20% 0.07% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 81.50% 18.50% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 83.20% 16.70% 0.13% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200789738 G -> A LOC_Os02g02370.1 synonymous_variant ; p.Gly251Gly; LOW synonymous_codon Average:79.512; most accessible tissue: Callus, score: 88.878 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200789738 G A 0.01 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200789738 NA 2.41E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 1.67E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 2.52E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 6.40E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 5.62E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 7.77E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 5.62E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 3.81E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 1.54E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 6.38E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 4.35E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 8.11E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200789738 NA 6.19E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251