Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138320877:

Variant ID: vg0138320877 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38320877
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTGCTCGTCGGGATCCTGTGCGCGCACGTCACCGTGGCGTGCCGCCCCACCATGCCGGAGGCGCTGAGGATGCTGGAGGGCGACATGGACGTGCCCGA[C/A]
CTGCCGGAACGGCCGCAGCCGTACGGCCAGAGGATCGCGTTCGACGAAGGCGAAGCCAATTTCAGCGCCTCGTCCGTGCTGAGCGGCCCCCCGTTCATGG

Reverse complement sequence

CCATGAACGGGGGGCCGCTCAGCACGGACGAGGCGCTGAAATTGGCTTCGCCTTCGTCGAACGCGATCCTCTGGCCGTACGGCTGCGGCCGTTCCGGCAG[G/T]
TCGGGCACGTCCATGTCGCCCTCCAGCATCCTCAGCGCCTCCGGCATGGTGGGGCGGCACGCCACGGTGACGTGCGCGCACAGGATCCCGACGAGCACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.80% 0.02% 0.00% NA
All Indica  2759 32.30% 67.70% 0.04% 0.00% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 39.30% 60.50% 0.17% 0.00% NA
Indica II  465 3.90% 96.10% 0.00% 0.00% NA
Indica III  913 46.10% 53.90% 0.00% 0.00% NA
Indica Intermediate  786 27.70% 72.30% 0.00% 0.00% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138320877 C -> A LOC_Os01g66020.1 missense_variant ; p.Asp606Glu; MODERATE nonsynonymous_codon ; D606E Average:87.008; most accessible tissue: Zhenshan97 flower, score: 98.227 benign -0.174 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138320877 C A -0.06 -0.04 -0.05 -0.04 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138320877 NA 1.23E-09 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 2.26E-08 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 1.43E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 4.57E-09 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 1.12E-08 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 1.34E-06 1.57E-08 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 4.41E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 1.23E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 3.79E-08 7.71E-19 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 4.34E-09 6.27E-20 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 2.53E-08 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 9.15E-06 3.28E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 2.12E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 7.55E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 1.92E-09 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 4.72E-06 NA mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 2.18E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 1.86E-11 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 2.36E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138320877 NA 2.36E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251